ID: 1052308413

View in Genome Browser
Species Human (GRCh38)
Location 9:27037725-27037747
Sequence ATTTTGTTCTTAAGGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052308413_1052308416 2 Left 1052308413 9:27037725-27037747 CCCTGGGTCCTTAAGAACAAAAT 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1052308416 9:27037750-27037772 AAAATTGCCTACCTGTGTTCTGG No data
1052308413_1052308421 23 Left 1052308413 9:27037725-27037747 CCCTGGGTCCTTAAGAACAAAAT 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1052308421 9:27037771-27037793 GGCAACACAATAGGAAGGCTTGG No data
1052308413_1052308420 18 Left 1052308413 9:27037725-27037747 CCCTGGGTCCTTAAGAACAAAAT 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1052308420 9:27037766-27037788 GTTCTGGCAACACAATAGGAAGG No data
1052308413_1052308419 14 Left 1052308413 9:27037725-27037747 CCCTGGGTCCTTAAGAACAAAAT 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1052308419 9:27037762-27037784 CTGTGTTCTGGCAACACAATAGG No data
1052308413_1052308422 24 Left 1052308413 9:27037725-27037747 CCCTGGGTCCTTAAGAACAAAAT 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1052308422 9:27037772-27037794 GCAACACAATAGGAAGGCTTGGG No data
1052308413_1052308423 30 Left 1052308413 9:27037725-27037747 CCCTGGGTCCTTAAGAACAAAAT 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1052308423 9:27037778-27037800 CAATAGGAAGGCTTGGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052308413 Original CRISPR ATTTTGTTCTTAAGGACCCA GGG (reversed) Intronic
900371335 1:2333484-2333506 ACTTTGTTCTGCAGGAGCCATGG - Intronic
902890430 1:19439394-19439416 CTTTTGTTCTTGAAGAACCACGG + Intronic
903343707 1:22671184-22671206 CTTTATTTCTTAAGAACCCATGG - Intergenic
903403040 1:23071482-23071504 ATTTGGTACATAAGGAGCCATGG + Intronic
904670074 1:32157856-32157878 ATTTTTTTATTAAGTACCTATGG - Intronic
904780861 1:32946511-32946533 ATTTTCTTCTTACGGCTCCATGG + Exonic
907941985 1:59096707-59096729 TTTTTGGCTTTAAGGACCCAAGG + Intergenic
909830684 1:80185569-80185591 ATTATGTTATAATGGACCCATGG + Intergenic
910417726 1:87018356-87018378 ATTTTGCACTTTAGGAGCCAGGG - Intronic
910672746 1:89789447-89789469 ATTTTGTTCTTTATGAGACAGGG - Intronic
911956956 1:104248646-104248668 ATTTTTTTCTTAAAGATACAAGG + Intergenic
911978034 1:104527382-104527404 ATTTTGCTCTTAAAAAACCAGGG - Intergenic
912008196 1:104930088-104930110 AATTTTTTTTTGAGGACCCAAGG + Intergenic
912197381 1:107414218-107414240 ATTTTGCTCTTCTGCACCCAAGG - Intronic
912757708 1:112338142-112338164 ATTATGTTCTTTAGTACCCCTGG - Intergenic
916382253 1:164225152-164225174 ACTTTGTTCTTAGGGACCCTAGG - Intergenic
917289613 1:173459759-173459781 ATTACGTTATTAAGAACCCAGGG + Intergenic
918945209 1:191055103-191055125 ATTTTATTCTTAAGGATCAAAGG + Intergenic
919157908 1:193790323-193790345 ATTTTGTTCTGAGGGACATAGGG + Intergenic
921482235 1:215676674-215676696 ATTTTCTTGTTGAGGACCCAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923057532 1:230438425-230438447 ATTTTGTGCTCAAGGACTGAGGG - Intergenic
1062770277 10:94475-94497 ACTTTGTTCTTTAGCACCCCAGG + Intergenic
1062786403 10:268958-268980 ATTTATTTCTGTAGGACCCACGG + Intergenic
1064482442 10:15753035-15753057 ATTATTTTATTGAGGACCCAAGG + Intergenic
1064927940 10:20590764-20590786 ATTGTGTTCTCAAGCACACAGGG - Intergenic
1065405512 10:25358905-25358927 ATATTCTTCTTAAGTACACATGG - Intronic
1066034024 10:31462532-31462554 CTTTAGTTCTTAAGGACCGATGG + Intronic
1066796881 10:39131887-39131909 AGTTTTTCCTTTAGGACCCAAGG - Intergenic
1067824983 10:49564627-49564649 ATTTTCTTCTTAAGCACACTTGG - Intergenic
1070468588 10:76752433-76752455 ATATTCTTCTCAAGGACACATGG + Intergenic
1070655486 10:78268298-78268320 ATTTTGTTCTGTAGGGCTCAAGG + Intergenic
1072009408 10:91290537-91290559 ATTTTCATCTTAAGCACCAACGG - Intergenic
1072096041 10:92181011-92181033 ATTTTATTTTTTAGGACGCATGG - Exonic
1072579228 10:96725484-96725506 ATTCTGTTCCTAAGAAACCAGGG - Intergenic
1072961045 10:99929508-99929530 CTTGTGTTCTTAAGGAGCCCGGG - Intronic
1073644948 10:105292228-105292250 ATTTTGTTCTGGAGGAAACACGG + Intergenic
1075567362 10:123514397-123514419 ATTTTGTTCAGTAAGACCCAAGG + Intergenic
1076444969 10:130508017-130508039 GTGTTGTTCTTCAGGTCCCAGGG + Intergenic
1087183175 11:95159262-95159284 ATTTTGTGCTAAAGGAACCAGGG - Intergenic
1088270583 11:108030328-108030350 ATTCTTATCATAAGGACCCATGG - Intronic
1089629637 11:119776270-119776292 ATTCTGTTCTGAGTGACCCAAGG - Intergenic
1091163632 11:133450086-133450108 CTTTTGTTCTTATGGTCACAAGG - Intronic
1091627068 12:2129613-2129635 ATTTTTCTTTTAAGGATCCAGGG - Intronic
1092783940 12:12011201-12011223 ATTTTGGTTTTATTGACCCAGGG + Intergenic
1094146644 12:27235618-27235640 ATTTTGTTCTTTAGGTCCAAAGG - Intergenic
1095244909 12:39908467-39908489 ATTTTGTTCCTCAGAACCCGAGG + Intronic
1095264039 12:40132857-40132879 ATTTTTATCTTTAGGACCTAGGG + Intergenic
1095406172 12:41869733-41869755 ATTTTGTTTTGAAGGACACTGGG - Intergenic
1095768118 12:45919098-45919120 ATTTTATTATTAAGGTTCCAGGG - Intergenic
1097311881 12:58127720-58127742 ATGTTCTCATTAAGGACCCAGGG - Intergenic
1098043982 12:66381118-66381140 GATTTGATCTTAAGAACCCAGGG + Intronic
1099099041 12:78413623-78413645 ATTTTGTCCTTAAGGTCTTAGGG - Intergenic
1100395889 12:94186069-94186091 ATTTTTTTCTTAAAGACACAGGG - Intronic
1105534820 13:21256143-21256165 ACTTAGTACTTATGGACCCACGG - Intergenic
1108002714 13:45919509-45919531 ATTAAGTTTTTAAGGACTCATGG - Intergenic
1110254867 13:73422059-73422081 AATATGTTATTAAGTACCCAAGG + Intergenic
1110590451 13:77251044-77251066 ATTTTTTTCTTAAAGACCAGTGG - Intronic
1110820580 13:79910596-79910618 CTGTTGTTCTTAAAGCCCCAGGG - Intergenic
1112132785 13:96542158-96542180 GTGTTGTTCTTAATGAGCCAGGG - Intronic
1112220887 13:97488609-97488631 ACATTTTTCTTAAGGACCAAAGG - Intergenic
1114072093 14:19120076-19120098 ATTCTGTTCTTGAGGATCCATGG + Intergenic
1114090163 14:19279888-19279910 ATTCTGTTCTTGAGGATCCATGG - Intergenic
1114269528 14:21092335-21092357 ATGTGGTTCTTAAGGAACCAGGG + Exonic
1114577486 14:23727477-23727499 ATTTAGTTCCTAAAGCCCCAGGG + Intergenic
1118226838 14:63908946-63908968 ACTTTGTTCTTCATGAACCATGG + Intronic
1118248801 14:64138227-64138249 TTTTTGTTTTTAAGGAGGCAAGG + Intronic
1121683448 14:95813882-95813904 AGTGTCTTCTTAATGACCCAGGG - Intergenic
1122740041 14:103867054-103867076 ATTTTGGTCTTGAAAACCCAGGG + Intergenic
1123130504 14:105981856-105981878 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1123409950 15:20049943-20049965 ATTTCATTCTGAAGGACCAAGGG - Intergenic
1123519282 15:21056650-21056672 ATTTCATTCTGAAGGACCAAGGG - Intergenic
1123580743 15:21713077-21713099 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1123617392 15:22155700-22155722 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1123951050 15:25275571-25275593 GTGTTGTTCTTAAGTGCCCATGG - Intergenic
1123954398 15:25319703-25319725 ATTTTGTTCTCAAATGCCCATGG - Intergenic
1125431139 15:39594557-39594579 ATTTTGCTTTTGAGGACACAAGG + Intronic
1125742361 15:41974147-41974169 ATTTTGCTCTTAAGGAAACTAGG - Intergenic
1126035916 15:44545166-44545188 ATTTTATACTTCAGGACTCAGGG + Intronic
1127433110 15:58931364-58931386 ATTTTGATCTTAAGCACACCTGG - Intronic
1128531295 15:68449924-68449946 ATTTTCTTCTTGATGCCCCAGGG - Intergenic
1129415125 15:75372282-75372304 ATTTTCTTCTAAAGGAGCAAAGG + Intronic
1129421208 15:75428318-75428340 GTTTTGTTTTTAAGGAGACAGGG + Intronic
1202989613 15_KI270727v1_random:447322-447344 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1134868333 16:17629198-17629220 ATTTACTTCTTAGGGTCCCAGGG - Intergenic
1135539268 16:23317464-23317486 TTTTTCTTCTCAAGGAGCCAGGG + Intronic
1138481140 16:57304104-57304126 ATTTTGGTCTCAGGGACCTAGGG - Intergenic
1138736279 16:59253629-59253651 ATTTGGATCTTAAGGAATCATGG - Intergenic
1138788770 16:59877508-59877530 ATTGTGTTCATAGAGACCCATGG + Intergenic
1139060985 16:63251183-63251205 ATTCTGATCCAAAGGACCCAAGG + Intergenic
1140297337 16:73721672-73721694 ATATTGTTCTCATGGAGCCAGGG - Intergenic
1140381092 16:74488544-74488566 TTTTTATTTTTATGGACCCAGGG - Intronic
1142682761 17:1560218-1560240 GTTTTGTTCCTAAGGAGCAAGGG - Intronic
1143857296 17:9861431-9861453 TTTTTGTCCTTACGTACCCAGGG - Intronic
1143954113 17:10655565-10655587 ATTTTGTTCTTAGCAACCCAAGG - Intronic
1144504857 17:15821310-15821332 AGTTTCTTCCTAAGGGCCCATGG + Intergenic
1144645915 17:16973290-16973312 AGTTTCTTCCTAAGGGCCCATGG - Intergenic
1145169030 17:20639193-20639215 AGTTTCTTCCTAAGGGCCCATGG + Intergenic
1145203592 17:20968632-20968654 AGTTTCTTCCTAAGGGCCCATGG + Intergenic
1146665116 17:34695828-34695850 ATTTGCTTCTTCAGGAGCCAGGG - Intergenic
1147155010 17:38540184-38540206 ATGTTGTGCTTAAGATCCCAGGG - Intronic
1148081861 17:44971212-44971234 TTTTTGTTCTTAATGAGACAGGG - Intergenic
1148398268 17:47328313-47328335 ATTCTGTCCTTAAGGACTCCAGG - Exonic
1149335684 17:55633336-55633358 CTTTTGTTCTTCAGGTCCTAAGG - Intergenic
1152260961 17:79266907-79266929 GTTTTGTTATAAAGGATCCAGGG - Intronic
1153393704 18:4592687-4592709 ATTTTGTTGATAAACACCCAAGG - Intergenic
1153964432 18:10167014-10167036 ACTTTGTTGCTAAAGACCCAGGG - Intergenic
1155851213 18:30776690-30776712 ATTTTGTTCTCAAAGACTTAAGG + Intergenic
1156256324 18:35400370-35400392 ATTTTCTTTTCAAGGACGCATGG + Intergenic
1158034033 18:53003016-53003038 ATTTTGTTTTGTAGGAGCCAAGG + Intronic
1158188913 18:54803419-54803441 ATTTTGTTCTCAAGGATCTTTGG - Intronic
1160075923 18:75677160-75677182 ATTTTATTCTTAAAGTTCCATGG - Intergenic
1160157061 18:76442171-76442193 ATGTGGTTCTTGAGGAACCAGGG + Exonic
1162607331 19:11719734-11719756 CTTTGGTTCTAAAGGACCTAGGG - Intergenic
1162677988 19:12314732-12314754 CTTTTGTTTTCAAGGACCCACGG - Intergenic
1164561988 19:29298927-29298949 ATTCTTCTCTTATGGACCCAAGG + Intergenic
1164722820 19:30444715-30444737 ATGTGGTTCTTGAGGAACCAGGG - Exonic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1168340103 19:55617851-55617873 CCTTTGTTCTTCAGGACCCCAGG - Exonic
1168542426 19:57224262-57224284 ATTTTATTTTTAAAGAGCCAGGG - Intergenic
925545967 2:5016811-5016833 ATTTTCTTGTTCAGGATCCAAGG + Intergenic
925633907 2:5923806-5923828 ATTTTGATTTTGTGGACCCATGG - Intergenic
926239449 2:11073938-11073960 ATTTTTTCCTTCAGGACACAAGG - Intergenic
926947003 2:18199338-18199360 TTTTTGTTCTTTAGAATCCATGG + Intronic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
928243381 2:29605957-29605979 ATTTTTTTCTTTGGGACCCAAGG - Intronic
928647781 2:33372993-33373015 ATTTGAATCTTAAGTACCCAGGG + Intronic
928783573 2:34854378-34854400 TGTTTGTTTTTCAGGACCCAAGG - Intergenic
932352622 2:71044258-71044280 ATATTGTCCTTAAGGTTCCAAGG - Intergenic
937011396 2:118565763-118565785 ATTTTGATCATAATGGCCCAGGG + Intergenic
937888377 2:126915990-126916012 ATTTTGCCCTTTAGGACACATGG + Intergenic
938803964 2:134788771-134788793 TTTTTGTGCTTAGGAACCCAAGG - Intergenic
940616237 2:156052089-156052111 ATTTTTTTGTAAAGGATCCAAGG - Intergenic
941604490 2:167580481-167580503 ATTTTCTCCTTAAAGTCCCAAGG - Intergenic
941868548 2:170359703-170359725 CTTTTGTTCTTTAAGACCCAAGG + Intronic
942999212 2:182303543-182303565 ATTTTATTCTTAAGGGGCCTGGG + Intronic
943609645 2:190016729-190016751 ACATTATTCTTAAGCACCCATGG - Intronic
943702812 2:191004788-191004810 TTTGTGTTCTTAAGGACTAATGG - Intronic
943945386 2:194055195-194055217 ATTTTGATCTTAATGACAGAGGG + Intergenic
944490310 2:200251908-200251930 ATTTTGTTCTTAAAGTCAGAAGG - Intergenic
947104820 2:226658501-226658523 ATTTTCTTCTCAATTACCCATGG + Intergenic
948101265 2:235374977-235374999 ATGTTTTTCTTAAGTGCCCATGG - Intergenic
1169520353 20:6365000-6365022 ATTTTATTCTCTAAGACCCAGGG - Intergenic
1170280524 20:14641836-14641858 ACATAGTTCTTAAGGAACCAAGG + Intronic
1170960319 20:21019960-21019982 ACTTTGCTCTTTAGGAACCAAGG - Intergenic
1171474197 20:25395134-25395156 ATTTTATTCTGAAGTAGCCACGG + Intergenic
1174514991 20:51084911-51084933 AGTTTGCTTTTAAGGACCAAGGG - Intergenic
1174792897 20:53496944-53496966 ATTTTGCTCTTCAAGACCGAGGG + Intergenic
1174899498 20:54483893-54483915 ATTTTGTTCTCTGGGATCCAGGG - Intronic
1175170762 20:57079859-57079881 TTTCTGTTCTTAAGGGGCCAGGG - Intergenic
1178874342 21:36401721-36401743 ATTTAATTCTTAAGAACACAAGG - Intronic
1180490535 22:15842431-15842453 ATTCTGTTCTTGAGGATCCATGG + Intergenic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
949714059 3:6907677-6907699 ATTTTTGTTTTAAGGAACCACGG + Intronic
952444543 3:33367964-33367986 ATATTGTTCTAAACAACCCATGG - Intronic
952672253 3:35984113-35984135 ATTTTGCACTAAAGGAACCAAGG + Intergenic
953714368 3:45304918-45304940 ATATTGTTCTCAAGTACACATGG + Intergenic
954933436 3:54304399-54304421 ATTTTGTTCTTAAGCTTCCTAGG + Intronic
956153185 3:66264790-66264812 ATTTTGTTATCAAGAAGCCAAGG - Intronic
956209988 3:66792557-66792579 ATTTTCTTCCAAAGGAACCAGGG - Intergenic
956503857 3:69916411-69916433 ATTTTATTATTAAAGACTCAAGG - Intronic
958521186 3:95188493-95188515 ATTTGGTTCTTAAAGTCCTAGGG + Intergenic
959473131 3:106777213-106777235 ATTTTGTTTTCAAGAACTCAAGG + Intergenic
961233783 3:125345115-125345137 ACATTTTTCTTAAGTACCCATGG + Intronic
961500724 3:127332340-127332362 ATTTTCTTCTCAAGCACACATGG + Intergenic
964891091 3:161536282-161536304 ATTTTGTTATGAATGAGCCAGGG + Intergenic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
970148450 4:13063486-13063508 ATATTCTTCTTAAGCACACAAGG - Intergenic
971033373 4:22666053-22666075 TTTCTGGTCTTAAGGACGCAGGG + Intergenic
971137730 4:23888265-23888287 ATTTTTTTCTTAAGGAGGAAAGG - Intronic
972937739 4:44159382-44159404 ATTTTTTTCTTAAGGACAATGGG - Intergenic
975110289 4:70615969-70615991 ATTTTGTTCTGTAGTTCCCAGGG + Intergenic
975112446 4:70642745-70642767 TATTTGTTCTTTTGGACCCAGGG - Exonic
976661484 4:87544866-87544888 GTTCTGTTTTTAAGGACCCATGG + Intergenic
977898480 4:102391884-102391906 ATGTTGTTATTATGAACCCATGG - Intronic
981005363 4:139869327-139869349 TCTATGTTCTCAAGGACCCAAGG + Intronic
981090015 4:140722551-140722573 ATGTTGATCTTAAGGAACCTTGG + Intronic
983431623 4:167658679-167658701 ATTTTCTTCTCAAGCACTCATGG - Intergenic
984684900 4:182656415-182656437 ATATTGTTCTTAAAGACCTGGGG + Intronic
985346027 4:189005364-189005386 GTTTTGATCCTAATGACCCAGGG - Intergenic
986236424 5:5914682-5914704 AGTTTCTTCTTCAGGACCCGGGG - Intergenic
986270235 5:6223803-6223825 TTTTTGTTCTGGAGGCCCCAGGG - Intergenic
987894666 5:23928582-23928604 ATATTTTAGTTAAGGACCCAAGG - Intergenic
988617833 5:32792691-32792713 ATTTTTTTTTTAAAGACACATGG - Intergenic
988818620 5:34859162-34859184 TTCTTCTTCCTAAGGACCCAGGG + Intronic
988965249 5:36410272-36410294 ATTTTAATTTTAAGCACCCATGG - Intergenic
989661337 5:43801489-43801511 CTTTTTTACTTAAGGACTCATGG + Intergenic
990854944 5:60254323-60254345 ATTGTGTTCTTTAGGGGCCAGGG - Intronic
992237101 5:74721688-74721710 ATTTTGATCTTGAGGATTCATGG + Exonic
993878800 5:93339744-93339766 ATTTTGTAGTTAAGAACCTAAGG - Intergenic
994801354 5:104381099-104381121 ATTTGGTTCTTAGGGAACTAGGG - Intergenic
995020204 5:107358640-107358662 ATTTTGTTTTCAAGGAACTATGG - Intergenic
995934354 5:117490270-117490292 ATTTTGTTTTTAAAGACAGATGG + Intergenic
996413921 5:123188954-123188976 ATTTTTTTCTTTATGGCCCAGGG - Exonic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
997811742 5:136977343-136977365 AATTTGCTCTTAAAAACCCAGGG + Exonic
999101801 5:149031500-149031522 ATCTTATTCTTGAGGACCCCAGG + Intronic
1001183729 5:169546791-169546813 ATGTTGGACTTAATGACCCATGG - Intergenic
1001801698 5:174550032-174550054 ACTTTGTTCTTAAGTAATCATGG - Intergenic
1003722006 6:8714173-8714195 ATTCTGTTCTATAGAACCCATGG - Intergenic
1003885156 6:10514840-10514862 ATTTTGTTCTTCAAAACCTAAGG + Intronic
1003890200 6:10557241-10557263 ACTTTGTTCTGCATGACCCACGG + Intronic
1007907023 6:45472171-45472193 ATTTTGTTTTTAACAATCCAGGG - Intronic
1010801558 6:80182100-80182122 ATTTTGTTCTTAAAATCGCATGG + Intronic
1012228665 6:96735222-96735244 TTTTTTTTCTTAAGTCCCCAGGG + Intergenic
1013437468 6:110125215-110125237 AATTTTTTCTTAGGGACTCACGG + Intronic
1015477147 6:133666821-133666843 ATTATGTTCATATGTACCCAAGG - Intergenic
1015585203 6:134769308-134769330 ATTTTGATTTTCAGGACCTATGG + Intergenic
1016072984 6:139762824-139762846 GTTTTTTTGTTAAGGACACATGG - Intergenic
1017152334 6:151291668-151291690 ATTTTGCTATTAAGCATCCACGG + Intronic
1018366054 6:163120949-163120971 ATTTTGCTCTTAAAGTCTCATGG - Intronic
1020349669 7:7204971-7204993 ATATTGTTCTCAAGTACACAGGG - Intronic
1020840197 7:13207818-13207840 ATATTCTTCTTAACTACCCATGG - Intergenic
1021027736 7:15688611-15688633 TTTTTATTCTTAAAGAGCCAAGG - Intergenic
1021188556 7:17593955-17593977 ATTTATTTCTTTAGTACCCAAGG + Intergenic
1021312912 7:19115576-19115598 ATTTATTTATTGAGGACCCATGG - Exonic
1024147149 7:46529248-46529270 CTTTTGTTCTTAAGGTATCAGGG - Intergenic
1028695424 7:93705156-93705178 ATTTTTTTCTAAAGGTCTCAAGG + Intronic
1029054162 7:97722953-97722975 ATTTTTTTCTTAATGCCTCATGG - Intergenic
1029303016 7:99599274-99599296 ATTATTTTTTAAAGGACCCATGG - Intronic
1031452464 7:121938598-121938620 ATGTTTTTCTCAAGGACCCGGGG - Intronic
1037171071 8:15892776-15892798 ATAAAGTTCTTTAGGACCCAAGG - Intergenic
1039815402 8:41089977-41089999 ATTATGTTCTAAAGCACACAAGG - Intergenic
1040592710 8:48809266-48809288 TTTTTTTTCTCAAGCACCCATGG + Intergenic
1041949292 8:63482531-63482553 ATTTTGTTTTTAATGACACTTGG + Intergenic
1042299498 8:67261388-67261410 ATGTAATTCTTAAGGACCCTGGG - Intronic
1042390821 8:68231652-68231674 ATTTTTTTCTTTATGTCCCAGGG - Exonic
1042499732 8:69495385-69495407 ATTTTTTTTTTAAAGAGCCAGGG - Intronic
1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG + Intergenic
1043266611 8:78274109-78274131 ATTCTGTTCTTCAAGACTCAAGG - Intergenic
1043823900 8:84901809-84901831 ATTTTGTTCTCATTGACCAATGG + Intronic
1043959324 8:86397911-86397933 ATTTTGTAATTAAGAAACCAAGG + Intronic
1044421244 8:91998259-91998281 ATTTTCTTTTTAAGGACGCTGGG - Intronic
1044472745 8:92589475-92589497 ATTTTGTTCTGAAGCCACCACGG + Intergenic
1044639140 8:94360228-94360250 ATTTTGCTCTTAATTACCAAAGG - Intergenic
1047937991 8:129800544-129800566 ATTATATTATTCAGGACCCAAGG + Intergenic
1048745279 8:137607762-137607784 TATTTGTTCTTAAGGATGCATGG - Intergenic
1049175795 8:141192132-141192154 CATTTCTTCTTAAAGACCCAGGG + Intronic
1049831755 8:144705264-144705286 ATTCTGTTCTCAGGGCCCCAAGG - Intergenic
1050455279 9:5828843-5828865 ATAATGTTCTTAAGCAACCATGG + Intronic
1050765145 9:9123671-9123693 CTTTTGTTCTGAAATACCCAAGG - Intronic
1051113727 9:13670290-13670312 ATTTTTTTCTTAGTGACCCTAGG + Intergenic
1052308413 9:27037725-27037747 ATTTTGTTCTTAAGGACCCAGGG - Intronic
1052426581 9:28312898-28312920 TTCTTGTTTTTAATGACCCAAGG + Intronic
1056453913 9:86742157-86742179 ATTATGGTTTTAAGGAACCAGGG - Intergenic
1060022186 9:120141212-120141234 ATTTTGTAAATAAGGACACAAGG - Intergenic
1060463507 9:123881527-123881549 AGTGTGTTCTTCAGGACCCTAGG + Intronic
1061704091 9:132439243-132439265 GTCTTGTTCTTCAGGACTCAGGG - Intronic
1061710292 9:132482742-132482764 TTTTTTTTCTTAAGAACACATGG + Intronic
1186844779 X:13519736-13519758 ATTTTTTTCTGAAGGACAGAGGG + Intergenic
1187375853 X:18753891-18753913 ACATTGTTCTCAAGGACACATGG - Intronic
1189223957 X:39397027-39397049 ATTTTGTTCAAAAAGACCCTTGG - Intergenic
1189827809 X:44937980-44938002 ACTTTGTTTTTAAAGACACAGGG + Intronic
1190734859 X:53249530-53249552 ATTTTGTAGATAAGGAACCAAGG - Intronic
1191149224 X:57202957-57202979 ATTGTTTTCTTAAGGTCCAAGGG + Intergenic
1192107525 X:68329650-68329672 ATATTTTTCTTAAGGACCTGGGG + Intronic
1193230046 X:79033035-79033057 AGTTTGTTCTTATAGACTCAAGG - Intergenic
1195097761 X:101521944-101521966 ATATTCTTCTCAAGGACACATGG - Intronic
1196034097 X:111124229-111124251 GCTTTGTTCTTCATGACCCAAGG + Intronic
1196522523 X:116690904-116690926 GTTTTGTTCCGAATGACCCAAGG - Intergenic
1198953622 X:142101854-142101876 ATTTTATTCTTAAGTATTCAAGG + Intergenic
1199572587 X:149282304-149282326 ATATTCTTTTTAAGCACCCATGG - Intergenic