ID: 1052311769

View in Genome Browser
Species Human (GRCh38)
Location 9:27075713-27075735
Sequence AGCTAGAGGCCCCTGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052311759_1052311769 24 Left 1052311759 9:27075666-27075688 CCAGGGGGATTCAGATCTCTGTC No data
Right 1052311769 9:27075713-27075735 AGCTAGAGGCCCCTGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052311769 Original CRISPR AGCTAGAGGCCCCTGCTGGG AGG Intergenic
No off target data available for this crispr