ID: 1052316143

View in Genome Browser
Species Human (GRCh38)
Location 9:27118073-27118095
Sequence GGGGACTCCACCCTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052316134_1052316143 13 Left 1052316134 9:27118037-27118059 CCTGGGTTGTGCAAGGCGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 667
Right 1052316143 9:27118073-27118095 GGGGACTCCACCCTGGGGACAGG No data
1052316132_1052316143 28 Left 1052316132 9:27118022-27118044 CCTTGGCACACAGGGCCTGGGTT 0: 1
1: 0
2: 0
3: 19
4: 449
Right 1052316143 9:27118073-27118095 GGGGACTCCACCCTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052316143 Original CRISPR GGGGACTCCACCCTGGGGAC AGG Intronic
No off target data available for this crispr