ID: 1052317358

View in Genome Browser
Species Human (GRCh38)
Location 9:27129468-27129490
Sequence TGCAAGGGGGAAGTGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052317358_1052317368 7 Left 1052317358 9:27129468-27129490 CCCCATGCCACTTCCCCCTTGCA 0: 1
1: 0
2: 0
3: 30
4: 300
Right 1052317368 9:27129498-27129520 CACTTGGCAGAACAAAAACCAGG No data
1052317358_1052317364 -9 Left 1052317358 9:27129468-27129490 CCCCATGCCACTTCCCCCTTGCA 0: 1
1: 0
2: 0
3: 30
4: 300
Right 1052317364 9:27129482-27129504 CCCCTTGCATATATACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052317358 Original CRISPR TGCAAGGGGGAAGTGGCATG GGG (reversed) Intronic
901120245 1:6885890-6885912 TGCATGGGAGGAGTGGCATGCGG - Intronic
901742300 1:11350278-11350300 TGCAGGGAGGAAGTGGTGTGCGG - Intergenic
904344939 1:29861598-29861620 TGCAATGGGGCAGTGGCAGAGGG + Intergenic
904701973 1:32363047-32363069 TGCAAGATGAAAGTGGCATGAGG + Intronic
905269215 1:36775937-36775959 TCCAAGGGAGAAATTGCATGAGG - Intergenic
905878884 1:41450765-41450787 TGCATGGGGGAAGAGGCAGAAGG + Intergenic
906130538 1:43452942-43452964 TGCAAGGGTGCTGTGGCAAGAGG - Intronic
906161874 1:43656029-43656051 TGCAAGGAGAAAGTTGGATGTGG + Intronic
906669907 1:47646792-47646814 AGAGAGGGGGAAGTAGCATGAGG - Intergenic
907047543 1:51308875-51308897 TTCATGGGGAAAGTGGCATTTGG + Intronic
907127859 1:52067298-52067320 TGCAAGGTGGAAGGAACATGTGG - Intronic
908602810 1:65759349-65759371 TGCCTGGGGGAAGGGGCAAGGGG - Intergenic
908924760 1:69241099-69241121 AGCATGGGGAGAGTGGCATGGGG - Intergenic
909658505 1:78056740-78056762 TGCAAGTGGGAAGGGGCACATGG - Intronic
909722379 1:78790485-78790507 TGCAAGAGGCAAGTTGCTTGGGG + Intergenic
909990521 1:82217792-82217814 GGCAAGGGTGAGGTGGGATGTGG - Intergenic
911155588 1:94633742-94633764 TGGAAAGGTGAAGTGGCTTGGGG + Intergenic
912078866 1:105911309-105911331 TGAAAGAGGGAAGGGACATGAGG + Intergenic
912403449 1:109416322-109416344 TGGAAGGGAAAAGTGGCATCAGG - Intronic
915121882 1:153634413-153634435 GGAAAGGGGGTGGTGGCATGTGG + Intronic
915145018 1:153791703-153791725 TGCAAGGACGAAGTGAAATGTGG - Intergenic
915334634 1:155134000-155134022 GGCAAGTGGGAAGAGGCGTGGGG - Exonic
915915107 1:159936337-159936359 TGCAAGGGGGCTGTGACCTGTGG - Intronic
916065358 1:161132148-161132170 GGGAAGGGGGCTGTGGCATGTGG - Intronic
916757288 1:167784797-167784819 TCTAAGGGGGAAGAGGAATGAGG + Intronic
917745816 1:178005924-178005946 AGAAAGGAGGAGGTGGCATGGGG - Intergenic
922719479 1:227893037-227893059 TGCAGGGGGGAAGTGACTGGAGG - Intergenic
1062923005 10:1293967-1293989 TGCAGGGGGGCGGGGGCATGGGG + Intronic
1063876198 10:10481524-10481546 TTCAAGGGGGAAATGGAGTGTGG - Intergenic
1064533548 10:16334475-16334497 TGCATGGGGAAAATGACATGTGG - Intergenic
1064761399 10:18625134-18625156 AGCAAGGGAAAAGAGGCATGGGG - Intronic
1064762449 10:18635261-18635283 AGCAAGGGAAAAGAGGCATGGGG - Intronic
1064944011 10:20768071-20768093 ATCAAGGAGGAGGTGGCATGGGG - Intergenic
1065153768 10:22849241-22849263 CCCAAGTGGGAAGTGGCTTGGGG + Intergenic
1065208177 10:23376661-23376683 TGAAAGGGGCAAGAGGCATTTGG + Intergenic
1066213942 10:33267588-33267610 TGCAAGGGGGACGGGGGACGGGG - Intronic
1067576447 10:47411741-47411763 TGCAATTGGGGAGTGGCCTGAGG + Intergenic
1067731202 10:48812682-48812704 TGCAAGGGAGAAGGTGCATACGG - Intronic
1069630272 10:69893420-69893442 TGGAAGGGAGAAGTGGCCTTTGG - Intronic
1070610903 10:77931752-77931774 TGCAGGAGGGAAGGAGCATGGGG - Intergenic
1070847702 10:79537442-79537464 AGCAAGGGGGTAGTAGGATGAGG - Intergenic
1070926080 10:80222687-80222709 AGCAAGGGGGTAGTAGGATGAGG + Intergenic
1071250888 10:83818407-83818429 TACAAAGGGGTAGTGGCAGGAGG - Intergenic
1071816185 10:89234525-89234547 TGCCAGAGGGAAGGGGCAAGAGG - Intronic
1073489974 10:103846701-103846723 TAGAAGGGGGAGGTGACATGTGG + Intronic
1074115481 10:110454752-110454774 TGCATGGGGCATGGGGCATGTGG + Intergenic
1075015201 10:118905607-118905629 TGCAAGGAGGAAGGGGCGTCTGG + Intergenic
1075298340 10:121297840-121297862 TGAAAGAGGGAAGTGGGGTGGGG - Intergenic
1075679933 10:124324556-124324578 TCCATGGTGGAAGAGGCATGGGG + Intergenic
1077350685 11:2091814-2091836 TGGAAGCGGGAAGAGGCAGGAGG - Intergenic
1080917402 11:36673815-36673837 TGCAAGGTGGAAGTGAGGTGGGG + Intergenic
1084568167 11:69943438-69943460 TGAAAATGGGAAGTGGCGTGGGG + Intergenic
1085591814 11:77770020-77770042 TTCAAGGATGAAGTGGCCTGTGG - Intronic
1085803965 11:79617571-79617593 TGAAAGGAGGAAGTGGGATGAGG - Intergenic
1087147735 11:94828537-94828559 GGCAAGGTAGAAGTGGCAGGAGG - Intronic
1087528810 11:99353039-99353061 TGGCAGGGGCAAGTGGCAGGTGG - Intronic
1088242758 11:107788368-107788390 AGCATGGGGGAAGGGGCAAGGGG - Intergenic
1088374191 11:109121788-109121810 TGCAGAGGGGATGTGGCATGAGG + Intergenic
1089323197 11:117640198-117640220 TGCCAGGTGGGAGTGGCAAGTGG - Intronic
1089949915 11:122516007-122516029 TGCAAGGGGCAAGGGGACTGGGG + Intergenic
1092118859 12:6029620-6029642 TGCAGGGGTGCAGTGGCAGGTGG - Intronic
1093278973 12:17167193-17167215 TGCTAGGAGGAGGTGGCATCTGG - Intergenic
1093501044 12:19812625-19812647 TGCAAGGGGGAAATGGAACCAGG + Intergenic
1094073621 12:26448351-26448373 TAAAAGGGGGAAATGCCATGGGG + Intronic
1096709647 12:53445991-53446013 TGCAAGGGGAAAGGGGAAAGGGG - Intronic
1098938412 12:76506746-76506768 TGGAAGGGGAAAGTGGCTGGGGG + Intronic
1099241058 12:80139483-80139505 TTAAGGAGGGAAGTGGCATGTGG - Intergenic
1099422190 12:82474421-82474443 TGTATGGGGGAACTGGCATCAGG + Intronic
1100701071 12:97149168-97149190 TGAAAGGGGGAAGCGGTATCAGG - Intergenic
1101017851 12:100520136-100520158 TGCATGGGGGAAGTGGGCTGCGG - Intronic
1101124325 12:101615353-101615375 TTCAAGGAGGAAGAGGGATGAGG - Intronic
1101489627 12:105199040-105199062 GGTGTGGGGGAAGTGGCATGAGG + Intronic
1101884470 12:108649846-108649868 TGCAAGGGGGGAGTTGAATGTGG + Intronic
1104218450 12:126758115-126758137 GGTAAGGGGGAAGGGGCAGGGGG + Intergenic
1104642985 12:130479225-130479247 TGCAGAGGAGAAGTGGCAGGTGG - Intronic
1104789549 12:131473099-131473121 GGCCAGGGGGAAGAGGCACGTGG + Intergenic
1105329605 13:19403203-19403225 TGTGAGGGGGCACTGGCATGGGG - Intergenic
1105862231 13:24425835-24425857 TGTGAGGGGGCACTGGCATGGGG + Intronic
1110184331 13:72655867-72655889 TGAAAGGGGGAAGAGGTAGGTGG + Intergenic
1111711141 13:91815889-91815911 TGGGAGGGAGGAGTGGCATGAGG - Intronic
1112247086 13:97745229-97745251 TGCAATGGGGAGGTGGAAAGGGG - Intergenic
1112527744 13:100168424-100168446 TGGAAGGAGGAAATGGCATGGGG + Intronic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1114629744 14:24151461-24151483 TGCAAGATGGGAGTGGCAAGGGG - Intronic
1114634065 14:24177659-24177681 TGCAAGGGGTAAGGGGCTTATGG + Intronic
1117277854 14:54207634-54207656 TTCAAGGCAGAAATGGCATGTGG + Intergenic
1117377291 14:55128478-55128500 CACAAGGTGGAAGTGGCAAGGGG + Intronic
1118481702 14:66173987-66174009 TGCAACAGCCAAGTGGCATGGGG - Intergenic
1118762966 14:68891900-68891922 TGGAAGGGGGAAGTGACTTCTGG + Intronic
1120355734 14:83431308-83431330 TGGAAGAGGGAAATTGCATGTGG + Intergenic
1120431326 14:84419366-84419388 TGCAAGGAGAAAGTAGCAGGAGG - Intergenic
1120440580 14:84533142-84533164 TGCAAAGGGAAAGGGACATGAGG - Intergenic
1120897635 14:89548006-89548028 TGGAAGGGGGAACTGGCAAAGGG + Intronic
1121223716 14:92306091-92306113 AGCAAGGGGAAAGGGGCATAGGG - Intergenic
1121434512 14:93910318-93910340 TGCACTGGGGAAGTTGCCTGAGG - Intergenic
1121436405 14:93923383-93923405 TGCAAGTGAGAAGAGGCATCTGG - Intronic
1122097199 14:99380832-99380854 AAAAAGGGGGAAGGGGCATGGGG - Intergenic
1122281028 14:100622464-100622486 TGGAAGGAGGAAGTGGCAGCTGG + Intergenic
1122341909 14:101034040-101034062 GGCAGCGGGGAACTGGCATGTGG - Intergenic
1122464015 14:101918392-101918414 GGCAAGGGGGGAGGGGCAAGGGG - Intronic
1124986394 15:34620337-34620359 TGGGAGGGAGGAGTGGCATGAGG - Intergenic
1126130955 15:45340745-45340767 TGCAAATGTGAAGTGGGATGTGG - Intergenic
1126755694 15:51923082-51923104 TGCAAGGGTGAAGAGGCAGAAGG + Intronic
1127268600 15:57380679-57380701 TGCAAAGGGGAGGTGGGAGGTGG + Intronic
1128190944 15:65696088-65696110 TGGAAGGGGAAAGTGACATCAGG - Intronic
1129044948 15:72725911-72725933 GGAAAGGGGGAAGGGGGATGGGG - Intronic
1129296110 15:74600998-74601020 TGCAAGGTGGAGGTGGCTGGAGG + Intronic
1129466524 15:75727286-75727308 TACAAGGAGGATGTGGCAGGAGG + Exonic
1130122225 15:81060875-81060897 TGGAATGGGGAAGGGGCCTGAGG - Intronic
1130906626 15:88245156-88245178 TGCATGAGGGAACTAGCATGTGG - Intronic
1131219792 15:90573054-90573076 AGCTAGTGGGAGGTGGCATGGGG - Intronic
1133052641 16:3125853-3125875 TGTCAGGGGGCAGTGGCTTGAGG + Intergenic
1133100381 16:3475789-3475811 TTGAAGGGGGATGAGGCATGGGG + Intronic
1133414653 16:5596903-5596925 TGGAGGGTGGATGTGGCATGAGG + Intergenic
1133427264 16:5703445-5703467 GGCAAGCTGGGAGTGGCATGAGG + Intergenic
1134597757 16:15509624-15509646 TGCATGGGGGAAGTGGGGTCTGG - Intronic
1134869471 16:17638725-17638747 AGCAAGGAGGAAGTGAAATGAGG + Intergenic
1135611998 16:23876431-23876453 TGGACGGGGGAAGTGTGATGTGG - Intronic
1138352592 16:56353877-56353899 TACAAGGGGCAAGGGGCAGGGGG - Intronic
1139577435 16:67850678-67850700 TGGAAGTGGGACCTGGCATGCGG + Intronic
1141360103 16:83387797-83387819 AGCAAGGGGAAAGTGCCAGGGGG - Intronic
1141607541 16:85163331-85163353 TGCAACCGAGAAGTGCCATGAGG - Intergenic
1142448903 16:90162136-90162158 TGCCAGTGGGAAATGGGATGCGG + Intergenic
1143281048 17:5754322-5754344 TGCAAGAAGGAAGTAGCATTTGG - Intergenic
1143502590 17:7347867-7347889 TGCAGGGGGGCAGTGGCCTGGGG - Intronic
1145011778 17:19372406-19372428 GGCCAGAGGGAAGTGGCAGGAGG - Intronic
1145751662 17:27359552-27359574 TGCCAGGGGGAAGGAGCATGTGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146901850 17:36593804-36593826 GGCGAGGGGGAAGGGGCGTGCGG - Intronic
1150228102 17:63534648-63534670 TGCACTGGGGGAGTGGCCTGGGG - Intronic
1151140480 17:71986833-71986855 GGAAAGTGGGAAGTGGAATGTGG + Intergenic
1151480589 17:74368262-74368284 TGCAAGGAGGTGGTGGCCTGGGG + Intronic
1151665916 17:75545109-75545131 TGCAAGGGGGCAGGGGTAGGGGG - Intronic
1153772815 18:8429154-8429176 TGGAAGGGTGAAGTGGGAAGAGG + Intergenic
1158188904 18:54803322-54803344 TGCCAGGCAGAAGGGGCATGAGG + Intronic
1159230694 18:65604888-65604910 TGAAATTGGGAAGTGGTATGAGG - Intergenic
1159265956 18:66079290-66079312 TAGAAGGGGGATGTGTCATGGGG + Intergenic
1159335819 18:67064218-67064240 AGCAAGGAGGAAGTGGCGGGGGG + Intergenic
1159500378 18:69261548-69261570 TGCATGTGGGAAGGGGAATGTGG - Intergenic
1159810804 18:73016164-73016186 TGCAAGAGGGAGGAGACATGAGG - Intergenic
1160294362 18:77623885-77623907 TGGAAGGGGGAAGGGGGAAGGGG - Intergenic
1161560022 19:4968155-4968177 TGCAAGGATTAAGTGGGATGAGG - Intergenic
1161887147 19:7005742-7005764 TTGAAGGGGGAAGAGGCCTGAGG - Intergenic
1161888056 19:7012160-7012182 TTGAAGGGGGAAGAGGCCTGAGG + Intergenic
1162193203 19:8963355-8963377 TGTAACGTGGAAGTGGCAGGAGG + Exonic
1162400975 19:10446426-10446448 GGCCTGGGGGAACTGGCATGTGG - Intronic
1162827330 19:13261382-13261404 GGCAGGGGGGAAGTGGCTAGAGG - Intronic
1163466689 19:17471922-17471944 TGGATGGGGGGAGTGGCAGGTGG - Intronic
1163484760 19:17579238-17579260 TGCAAGGCGGGAGGTGCATGAGG + Intronic
1163572602 19:18091197-18091219 GGCAAGGGGAAGGTGGGATGTGG - Intronic
1164805486 19:31113067-31113089 TGGAAGGGGGAAGGGGGAAGGGG + Intergenic
1165125844 19:33596577-33596599 TGCAAAGGGGAGTGGGCATGGGG + Intergenic
1165323260 19:35099250-35099272 TGCAAGTTTGAAGTGGCCTGTGG + Intergenic
1165363935 19:35352461-35352483 TGCTCGGGGGAAGGAGCATGGGG + Exonic
1165906536 19:39197865-39197887 TGCCAGGGGTAAGTGGGGTGTGG - Intronic
1166100116 19:40566602-40566624 TGGGAGGGGGAACTGGCCTGGGG + Intronic
1167319516 19:48787653-48787675 AGGAAGGGGGAAGTGACTTGTGG + Intergenic
925306482 2:2850755-2850777 TGCTAGGAGTAAGTGGCAGGTGG - Intergenic
925425914 2:3748480-3748502 GACAAGGGGGAAGTGGGAGGAGG + Intronic
925924069 2:8658155-8658177 TGCAAGTGGGAAGAGGCAGCAGG + Intergenic
926549973 2:14289239-14289261 TTCTAGAAGGAAGTGGCATGAGG - Intergenic
928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG + Intronic
928600426 2:32899002-32899024 GACAAAGGGGAGGTGGCATGGGG - Intergenic
929777832 2:44939480-44939502 TGGGAGGGGGAAGGGGCAGGAGG - Intergenic
931784024 2:65602957-65602979 TGCCAAGGGGAATTGGCATAGGG + Intergenic
933973950 2:87492841-87492863 AGGACGGGGGAAGAGGCATGAGG - Intergenic
936102060 2:109590794-109590816 AGCAAGGGAGAACTGGCAGGTGG - Intronic
937263164 2:120599249-120599271 TGCCAGCGGGAAGTGGGAAGGGG - Intergenic
938922530 2:136008388-136008410 GGCAAGGGGGAAGTGACAAAGGG - Intergenic
939297812 2:140292461-140292483 TGCAAAGCGGAAGTAGCAAGGGG - Intronic
939597075 2:144138395-144138417 TAGAAGGGGGAAGTGGAATAAGG + Intronic
942229136 2:173843341-173843363 TGCAAGGGACAAGTGGCAGTCGG - Intergenic
942326716 2:174782204-174782226 TGAGAGGAGGAGGTGGCATGGGG + Intergenic
943415810 2:187602675-187602697 TGCAAGTTGGATTTGGCATGTGG + Intergenic
945002122 2:205363060-205363082 TGCAAGGGGAGAGGGGCCTGTGG - Intronic
946155528 2:217804412-217804434 TGCCATGGGGAAGGGGCTTGTGG - Exonic
946397855 2:219452257-219452279 AGTAGGGGGGAAGTGGCTTGTGG - Intronic
946520147 2:220455786-220455808 TGCAAGGAGAAAGTGGAATGGGG + Intergenic
949046452 2:241874590-241874612 TGCGGGGGAGAAGTGGCAGGGGG + Intergenic
1168749829 20:274554-274576 TGAAAGGGGTAAGGTGCATGTGG - Intronic
1170358305 20:15517168-15517190 AGCAAGGGAGAAATGGTATGTGG - Intronic
1170661720 20:18348130-18348152 TGCAGCAGGGAAGTGGCAAGAGG - Intergenic
1172202236 20:33134535-33134557 TGCAGGGGGGAAGCCGCGTGAGG + Intergenic
1172374822 20:34430031-34430053 TTCAAGGGAGAAATGGCATTTGG + Intronic
1172829495 20:37821171-37821193 TTCAAGGAGGAAGTAGGATGAGG - Intronic
1175053739 20:56178843-56178865 GGGAAGTGGGGAGTGGCATGGGG - Intergenic
1176520194 21:7818471-7818493 TGCAAGGGAGGAGTGGAAGGCGG + Exonic
1176847042 21:13884773-13884795 TGGAAGGGGGATGTGGGATGTGG - Intergenic
1176985426 21:15430996-15431018 GGGAAGGGGGAAGTGGGAAGAGG - Intergenic
1178249892 21:30992528-30992550 TGGAAGGGTGGAGTGGGATGAGG - Intergenic
1178371675 21:32032057-32032079 TGCAAGGAGGAAAGTGCATGAGG - Intronic
1178654220 21:34448483-34448505 TGCAAGGGAGGAGTGGAAGGCGG + Intergenic
1178704492 21:34861985-34862007 TGCAAGTGGGAAGGGGCTTTAGG + Intronic
1179394444 21:41025076-41025098 TACTAGGGAGAAATGGCATGCGG + Intergenic
1179659119 21:42863368-42863390 TACATGGGGGACGTGGCACGTGG - Intronic
1179726112 21:43341968-43341990 TGCAGGGGGTGAGCGGCATGTGG + Intergenic
1181685643 22:24525920-24525942 GGCAGGGGGAGAGTGGCATGGGG + Exonic
1182046111 22:27275434-27275456 TCCAAGGGGGAGGTGGCATTTGG - Intergenic
1182934409 22:34207602-34207624 TGCAAAGGCGAAGTGGCATAGGG + Intergenic
1183508176 22:38220745-38220767 GGCCAGGGGGAAGGGGCATGAGG + Exonic
1184125074 22:42481191-42481213 TGGAAGAGGGAGGAGGCATGTGG + Intergenic
1184253801 22:43275906-43275928 TGCAGGAGGGAAGGGGGATGAGG + Intronic
1184273480 22:43397762-43397784 TGCAGGGGGCAGGTGGCAGGTGG + Intergenic
1184702753 22:46187751-46187773 CTCAAGGGAGAAGTGGCAAGAGG - Intronic
950463563 3:13139926-13139948 TGCAAGTGCAAAGTGGCCTGTGG - Intergenic
951531230 3:23699953-23699975 TGCAATGGGGAAGAGCAATGGGG + Intergenic
952050893 3:29383398-29383420 TTCAAGGGGTAAGTAGCATTAGG - Intronic
953179428 3:40582372-40582394 TGCAAAGGGGGAGGGGCAGGAGG + Intergenic
953428651 3:42818319-42818341 AGAAAGGAGGAAGTGGCATCAGG - Intronic
953479189 3:43234889-43234911 TGCAAGTGGGAGGAGGCATTTGG - Intergenic
953911757 3:46896729-46896751 TGCAAGCTGGGAGTGGAATGTGG + Intronic
954539658 3:51385183-51385205 ACCAATGGGGAAGTGGCATGTGG + Exonic
954976413 3:54699293-54699315 AGCAAGGGGGAAGGGGCTGGAGG + Intronic
955238300 3:57159366-57159388 GGCAGAGGGGAAGTGGCCTGTGG + Intronic
960674094 3:120178135-120178157 TGCAAGGGGGCAGTGGTGAGAGG + Intronic
961050020 3:123738018-123738040 GGCAGGGAGGCAGTGGCATGGGG - Intronic
961677498 3:128576637-128576659 TACAAAGGGGGAGTGGCAGGAGG + Intergenic
961790325 3:129371277-129371299 AGCAAGTGGGGAGTGGCAGGCGG + Intergenic
962944994 3:140160005-140160027 TAGAAGGGGAAAGTAGCATGGGG + Intronic
963251187 3:143104910-143104932 TGCACGGGGGAAGGTGCCTGGGG - Intergenic
964181251 3:153889130-153889152 CCCAAGTGGGAAGTGTCATGTGG - Intergenic
964584307 3:158279770-158279792 AGGAAAGAGGAAGTGGCATGGGG - Intronic
967939293 3:194754002-194754024 TGCAAAGGGGAGGGAGCATGCGG + Intergenic
968626384 4:1628286-1628308 GGCATGGGGGGGGTGGCATGGGG + Intronic
968626560 4:1628716-1628738 TGGCATGGGGGAGTGGCATGGGG + Intronic
968626582 4:1628762-1628784 TGGCATGGGGGAGTGGCATGGGG + Intronic
969274735 4:6127666-6127688 TGAAGGGGGGATGTGGCCTGTGG - Intronic
969938663 4:10708099-10708121 TGACAGGAGGAAGTGGCAGGAGG + Intergenic
970659902 4:18273557-18273579 TGGAAGTGGGAAGTGGAAAGTGG + Intergenic
971223933 4:24733945-24733967 TGAAAGAGGGAGGTGGCAAGTGG + Intergenic
971724993 4:30300018-30300040 TGCAATTGGAAAGTGGCAAGAGG + Intergenic
977887572 4:102271008-102271030 GGAAAGGGAGAAGTAGCATGAGG + Intronic
979671453 4:123364032-123364054 TGCATGGGGAAAATGTCATGAGG - Intergenic
981704883 4:147648443-147648465 AGCATGTGGGAAGTGGCATGGGG - Intronic
985491961 5:185570-185592 TTCACGGGGGCAGTGGCATTTGG - Exonic
985695260 5:1336519-1336541 TGCAAGGAGTCAGCGGCATGAGG + Intronic
985866230 5:2516553-2516575 TGCAGGGAGGAAGCGGCGTGAGG - Intergenic
985928519 5:3036110-3036132 TGCAAGGCGGAGGTGGGAGGGGG + Intergenic
986539432 5:8828353-8828375 ACCAAAGGGGAAGTGGCAAGTGG + Intergenic
987327932 5:16829159-16829181 TGCAAGGGTGATGTGGCACGGGG + Intronic
989173271 5:38494451-38494473 GGCAAGGGGCAAGGGGCAAGGGG + Intronic
989959579 5:50395563-50395585 TGGCAGGGGAAAGTGGAATGAGG + Intergenic
990493175 5:56321612-56321634 AGCAGGGGGTAAGTGGCAGGTGG - Intergenic
990678630 5:58216323-58216345 TGCAAGGAGGCAGTGGGCTGGGG + Intergenic
993837741 5:92835555-92835577 TGCACGGGGCAAGGGGCAAGGGG - Intergenic
994264246 5:97696015-97696037 TGCAAGGGGGAGATGGCAACAGG + Intergenic
994534703 5:101014105-101014127 TACAAGTGGGGAGTGGGATGAGG + Intergenic
994626970 5:102232334-102232356 TGCAGGGGGGAACTGGAGTGTGG + Intergenic
995240348 5:109878578-109878600 TGCAATGGGAAAGTGTGATGTGG + Intergenic
997006865 5:129827415-129827437 TACAAGAGGGAAGAGGCAGGGGG + Intergenic
997399292 5:133590242-133590264 TGAAAGGGGGCAGTGTCATCTGG - Intronic
999190997 5:149747577-149747599 CCCAAGGAGAAAGTGGCATGAGG - Intronic
999651456 5:153771515-153771537 TGCAAGAATGTAGTGGCATGAGG - Intronic
1000260635 5:159585197-159585219 GGCCAAGGGGAAGGGGCATGAGG - Intergenic
1000843565 5:166251767-166251789 TGCAAGCCGGATGTGGCTTGTGG - Intergenic
1000872952 5:166600102-166600124 TGCGAGGGGAAAATGGCATGAGG - Intergenic
1000982208 5:167827958-167827980 TGCAAGGTGGGTGTGGCATTTGG - Intronic
1001118389 5:168958605-168958627 TGAAAGGTGGAAGTGTCATATGG - Intronic
1001740708 5:174050834-174050856 TGAAAGGGAGAAGAGGCAGGAGG - Intronic
1002001844 5:176200447-176200469 TACACAGGGGAAGTGGGATGTGG + Intergenic
1002005834 5:176233963-176233985 TGGATGGGGGAAGTGGCAAAAGG + Intergenic
1002252494 5:177938531-177938553 TACACAGGGGAAGTGGGATGTGG - Intergenic
1002498309 5:179631107-179631129 TGCATGGGGGTAGTGGGATGGGG + Intronic
1002877757 6:1226507-1226529 TGAAAGGGGGGAACGGCATGAGG + Intergenic
1003094492 6:3131753-3131775 TGCAAAGGCGAAGAGGCATGAGG - Intronic
1005900911 6:30215404-30215426 ACCGAGGGAGAAGTGGCATGAGG - Intergenic
1006384914 6:33725346-33725368 TGCAGGGGGGCAGTGGCATCTGG + Intronic
1006672816 6:35740221-35740243 GGAAAGGGGGAAGTGACATGTGG - Intronic
1008842307 6:55918280-55918302 AGCAAGGGAGAAGTATCATGTGG - Intergenic
1012654585 6:101799561-101799583 TGCAAGGAGGAAGAGGGAAGAGG - Intronic
1014802175 6:125790343-125790365 TGTAAGGGGGAAGCGGCCCGGGG + Intronic
1016367647 6:143336902-143336924 TGTAAGGGAGAAGTTGCAGGGGG + Intronic
1017814776 6:158008939-158008961 TTCATGGAGGAAGTGGCGTGGGG - Intronic
1019282502 7:207553-207575 TGCAAAGGGGAAGAGGGAAGCGG - Intronic
1020254686 7:6496515-6496537 TGCAAGGGGGATGTGGCTAGTGG - Intergenic
1021217877 7:17940038-17940060 TGCCAGGGGCGAGTGGCAAGTGG + Intronic
1022385295 7:29893305-29893327 TACAAGGGGGAGATGCCATGTGG + Intronic
1024791325 7:52967849-52967871 TGCAAGGAGGAAAGGCCATGTGG - Intergenic
1024923177 7:54582536-54582558 TGCATGGGGCAGGTGGCATATGG + Intergenic
1028406149 7:90476375-90476397 TTTAACTGGGAAGTGGCATGGGG + Intronic
1030619320 7:111772087-111772109 TGCCAGGGGTAAGAGGAATGGGG + Intronic
1030781368 7:113604269-113604291 TGTAATGGGGCAGAGGCATGAGG + Intergenic
1031623668 7:123967680-123967702 TGCAAGAAGGAAGGGGGATGTGG + Intronic
1032061170 7:128726617-128726639 GGGAAGGGGGAGGTGGAATGGGG - Intronic
1032408611 7:131676069-131676091 GGCAAGTGGCAAGTGGCAAGTGG - Intergenic
1032436812 7:131907488-131907510 TGGAAGGGAGAAATGGGATGGGG + Intergenic
1033621880 7:143069238-143069260 TGCAAGGGGCAGGTGGCCAGGGG + Intergenic
1034930339 7:155156514-155156536 TGCAAGGAGCCAGTGGAATGAGG + Intergenic
1035389588 7:158496365-158496387 GGGAAGGGGGAAGGGGCGTGGGG - Intronic
1038258988 8:25977179-25977201 TGCAAGGGAGAAGTGGCTCGGGG + Intronic
1039029356 8:33293040-33293062 TGGAAGGGTGAAGTAGGATGTGG + Intergenic
1039767160 8:40640883-40640905 TGCAAGGTGGAAGTTGCAGTGGG + Intronic
1039793109 8:40891241-40891263 AGCAAGGGGGAAGGGGGAGGGGG + Intronic
1040596033 8:48838668-48838690 TGCAAGGAGGAAGTGCCTGGTGG - Intergenic
1045225127 8:100236524-100236546 TGCAATGAGGAAGTGGCACAGGG + Intronic
1045429254 8:102098019-102098041 TGCAAAGGGCATGTGGCATGAGG + Intronic
1046797207 8:118386289-118386311 TGCAAGGGGGTACTGGCAGCTGG - Intronic
1048137232 8:131758259-131758281 TGGGAGGAGGGAGTGGCATGGGG - Intergenic
1048721129 8:137326602-137326624 TGTAAGGGTGAAGTGGGATTAGG + Intergenic
1048747753 8:137634011-137634033 TTCAAGGGGGAAGTGTGCTGTGG + Intergenic
1048994861 8:139788091-139788113 TGCAGTGGGGAAGTGGCTTCTGG - Intronic
1049279384 8:141736652-141736674 TGCTGGGTGGCAGTGGCATGAGG - Intergenic
1049741788 8:144244543-144244565 TGCAGGGGGGAACTGTCATGGGG + Intronic
1052317358 9:27129468-27129490 TGCAAGGGGGAAGTGGCATGGGG - Intronic
1053156733 9:35786248-35786270 GGCAAGAGGCAAGTGGCAAGAGG - Intergenic
1053928303 9:43089633-43089655 TCCACGGGGGAAGGGGCAGGCGG - Intergenic
1056177654 9:84051124-84051146 TGAAAGAGGGAAGTGGGGTGAGG - Intergenic
1057550841 9:96050019-96050041 TGCAGGGGGGAAATGTCAGGTGG - Intergenic
1060269705 9:122131899-122131921 GGCTGGGGGGAAGAGGCATGGGG + Intergenic
1060876973 9:127090559-127090581 TGCTATGGGGACCTGGCATGAGG + Intronic
1061669386 9:132180120-132180142 AGCAGGAGGGAAGTGGAATGAGG - Intronic
1061912912 9:133734309-133734331 TGCCATGGGGAAGTGGCAAGAGG - Intronic
1062054463 9:134463724-134463746 TCCAAGGGGGCAGGGGGATGGGG - Intergenic
1062136612 9:134932105-134932127 TCCAATGGGGAAGGAGCATGTGG - Intergenic
1062477987 9:136738832-136738854 TTCCTGGGGGAAGTGGCATTTGG - Intronic
1062572444 9:137191887-137191909 TCCAAGGGGGAAGTGGGGTGGGG - Exonic
1185593281 X:1292483-1292505 GGCAAGGGGAATGTGGCAGGAGG + Intronic
1185828498 X:3275974-3275996 TGCAATGGTGCAGTGGCATTAGG + Intronic
1186144752 X:6613651-6613673 GCCAAGGGGGAAGTGAGATGGGG - Intergenic
1187583656 X:20636429-20636451 TGCAGGGGCCAAGTGGCAGGAGG - Intergenic
1187747581 X:22426410-22426432 GGCAAAGGGGAGGTGGCATGTGG + Intergenic
1189299583 X:39942808-39942830 AGCAAGGAGGAAGGGACATGTGG + Intergenic
1191675253 X:63785832-63785854 TGGAAGAGGGAAGGGGCATAAGG + Intergenic
1192916736 X:75659494-75659516 TGCAAGGAGGGAGGGGGATGTGG - Intergenic
1195322203 X:103729085-103729107 TACAAGGGCGAGGTGGGATGGGG - Intergenic
1196411195 X:115420933-115420955 TGAATGGGGGGTGTGGCATGGGG + Intergenic
1197990342 X:132310771-132310793 TGGAAGGAGGAAGAGGCTTGGGG - Intergenic
1199386358 X:147227842-147227864 TGCACGGGGCATGTAGCATGAGG - Intergenic
1200073820 X:153541578-153541600 TGGAAGGAGGAAGAGGAATGGGG + Intronic
1200823096 Y:7608454-7608476 AGCATGGTGGAACTGGCATGGGG - Intergenic
1202236959 Y:22722641-22722663 AGCATGGTGGAACTGGCATGGGG + Intergenic