ID: 1052325921

View in Genome Browser
Species Human (GRCh38)
Location 9:27216716-27216738
Sequence CAGCCCTGCCCTAGATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052325921_1052325923 0 Left 1052325921 9:27216716-27216738 CCTTGGGATCTAGGGCAGGGCTG 0: 1
1: 1
2: 1
3: 32
4: 269
Right 1052325923 9:27216739-27216761 GTCTCATAAATGCATGACCTAGG No data
1052325921_1052325924 16 Left 1052325921 9:27216716-27216738 CCTTGGGATCTAGGGCAGGGCTG 0: 1
1: 1
2: 1
3: 32
4: 269
Right 1052325924 9:27216755-27216777 ACCTAGGAGAACACCTGCTCTGG No data
1052325921_1052325927 30 Left 1052325921 9:27216716-27216738 CCTTGGGATCTAGGGCAGGGCTG 0: 1
1: 1
2: 1
3: 32
4: 269
Right 1052325927 9:27216769-27216791 CTGCTCTGGAGAGCTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052325921 Original CRISPR CAGCCCTGCCCTAGATCCCA AGG (reversed) Intronic
900138863 1:1130712-1130734 CAGCCCTGCCCCAGGCCCGAGGG - Intergenic
900392318 1:2439029-2439051 CAGCCCTGACCCAGCTCCCAGGG + Intronic
900687851 1:3959974-3959996 CAGCCCTGTGCTAGAATCCAGGG - Intergenic
901456512 1:9366179-9366201 CAGCTCTGCCCAAGTTCCCCTGG + Intronic
901730146 1:11273274-11273296 CAGCCCCGCGTTAGAGCCCACGG - Exonic
901741195 1:11343075-11343097 CAGCCTTTGCCTAGACCCCAGGG + Intergenic
901842238 1:11960953-11960975 CAGCCCTGCCCAGGAGCCCCGGG - Intronic
902290046 1:15429460-15429482 CTTCCCTGCCCATGATCCCACGG - Exonic
902727968 1:18350015-18350037 CAGCCCTGGCCCTGAGCCCATGG + Intronic
902753877 1:18536650-18536672 CAGCCCATTCCTAGATCCCAGGG - Intergenic
903330598 1:22595171-22595193 CAGCCCTGGCCTTGGGCCCAGGG - Intronic
903449401 1:23442603-23442625 CAGCTTGGCCCTAGACCCCAAGG + Exonic
903650193 1:24917267-24917289 CAGCCCTGCCCTATGTCTCCAGG - Intronic
904282132 1:29427956-29427978 AAGCTGTGCCCTAGATGCCAGGG - Intergenic
904623491 1:31789344-31789366 CAGCCCCGACCTCCATCCCAAGG + Intergenic
905151580 1:35931602-35931624 CAGCCCAGCCCCAGTTCCCCGGG + Intronic
905395274 1:37662635-37662657 CTGCACTGCCCTACACCCCAAGG - Intergenic
906318696 1:44803842-44803864 TGGCCCTGCCCTGGCTCCCAGGG - Intronic
907157594 1:52348795-52348817 CAGGCCTGCGCTAGCTTCCAGGG - Intronic
912515731 1:110215500-110215522 CAGCCCTGCCCTGGAGACCTTGG - Intronic
915981965 1:160425899-160425921 TATCCCTGCCCTAGAACCCAGGG - Exonic
919780069 1:201215896-201215918 CAGGCCTGCCCTTGATGGCAGGG - Intronic
920386720 1:205575100-205575122 CCAGCCTGCCCTAGCTCCCAGGG + Intronic
920648083 1:207817936-207817958 CTGCCCTGCTCTGGCTCCCAAGG + Intergenic
921282678 1:213582924-213582946 CACCCATGGCCTAGATTCCAGGG + Intergenic
923040798 1:230318674-230318696 CGCCTCTGGCCTAGATCCCAGGG + Intergenic
923641978 1:235772664-235772686 AAGCCTTGCCCTATATACCATGG + Intronic
924830468 1:247588796-247588818 GAGCCATGCCATAGATGCCAAGG - Exonic
1064365275 10:14701843-14701865 CAGCCCTGCTCCAGGTTCCAGGG - Intronic
1065424722 10:25587680-25587702 CAGACCTACACTAGATCTCATGG + Intronic
1069993578 10:72329349-72329371 CAGCCCTGCCCTCCCTCCCTAGG + Intergenic
1071165241 10:82798880-82798902 CAGTCCTTCTCTATATCCCAAGG - Intronic
1072439078 10:95438168-95438190 CAGGCCTGCCCAAGATCACTAGG + Intronic
1074199395 10:111221267-111221289 AAGCTCTGCCCTGTATCCCAGGG - Intergenic
1074261939 10:111862957-111862979 TTGCCCTGACCTATATCCCATGG + Intergenic
1075219579 10:120572892-120572914 CAGCCCTGCTCTAGATACTGTGG - Intronic
1076849557 10:133086330-133086352 GAGCCCTGCCCTGAGTCCCACGG - Intronic
1076890901 10:133282871-133282893 CAGCCCTGCCCACGCTGCCAGGG + Intronic
1077391319 11:2301897-2301919 CAGCCCAGCCCAAGACACCAGGG - Exonic
1077516065 11:3002823-3002845 TGGCCCTGCCCTAGATGCAAAGG + Intronic
1078020431 11:7652206-7652228 CAGCTTTGACCAAGATCCCACGG - Intronic
1080501378 11:32874591-32874613 CAGCCCTCACCTAGATTTCAAGG + Intergenic
1081966456 11:47173106-47173128 CAGCCCTGCCTCAGAGCCCAGGG + Intronic
1083936790 11:65873503-65873525 CAGCCCTGCCCTCCTTCTCAGGG - Intronic
1084906545 11:72352759-72352781 AAGCCCTGCCCTAGGCACCAAGG - Intronic
1084968258 11:72755670-72755692 CACCCCTCCCCAAAATCCCAAGG + Intronic
1085294357 11:75422614-75422636 CAGCGCTGCACCAGCTCCCACGG - Exonic
1085730173 11:78991187-78991209 CTGTCCTGCCCAAAATCCCAGGG + Intronic
1088758300 11:112905751-112905773 AAGCACTGTTCTAGATCCCAGGG + Intergenic
1089600547 11:119611770-119611792 GAGACCTGCCCTAGATTCTATGG - Intergenic
1089616682 11:119698814-119698836 CAGCCCTGTCCATGATCCTAGGG - Intronic
1091619682 12:2076931-2076953 CAGCCCTCTCCTGGATTCCAGGG - Intronic
1096580418 12:52581276-52581298 CAAGCCTGCCCTAGGCCCCACGG - Intergenic
1098289418 12:68943019-68943041 GAGCTCTGACCTAGATGCCATGG - Intronic
1101761088 12:107659803-107659825 CAGCCAAGCCCTAGTCCCCATGG + Intergenic
1101848524 12:108383393-108383415 ATGTCTTGCCCTAGATCCCATGG + Intergenic
1101862345 12:108493519-108493541 CAGTCTTGCTCTACATCCCAGGG + Intergenic
1102236797 12:111298756-111298778 CTGCCCTCCCCAAGCTCCCAGGG + Intronic
1102454073 12:113060782-113060804 CAGCCCTGCCCTCTACCCCTAGG - Intronic
1102978119 12:117221042-117221064 CAGACCTCCCCAAGATCCCATGG + Intronic
1104031452 12:125067998-125068020 CAGCTCTGCCCTGGGTCCCTGGG + Intronic
1104464886 12:128982229-128982251 CAGCCCTACCCCAAGTCCCAGGG - Intronic
1104752314 12:131247571-131247593 AAGCCCTGCCCTTGACCCCTGGG - Intergenic
1104771263 12:131366253-131366275 CAGCCCAGCCCAAGCTCCAAGGG + Intergenic
1104860601 12:131921468-131921490 GAGCCCTGCCCTGGGCCCCACGG + Exonic
1105428294 13:20314726-20314748 CAGGCTTGTCCTTGATCCCAAGG - Intergenic
1106408677 13:29496169-29496191 CACCCCTTCCCCAGGTCCCAGGG - Intronic
1106466988 13:30022404-30022426 CAGCCCTGCCTTCCATTCCAGGG + Intergenic
1106902291 13:34366628-34366650 CAGCCCTGCCCCAGATGCTGAGG + Intergenic
1109134221 13:58626068-58626090 CAGGTCAGCCCTAGATCCCCTGG - Intergenic
1111436063 13:88209736-88209758 CAGCATTCTCCTAGATCCCATGG + Intergenic
1111835988 13:93388841-93388863 AAGCCCTTTCCTAGATGCCAGGG - Intronic
1112569982 13:100585457-100585479 CACCCCTGCCCTAGATTGAAAGG + Intronic
1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG + Intergenic
1113695502 13:112342986-112343008 CAGCGATGCCCGAGAGCCCAAGG + Intergenic
1117871654 14:60207395-60207417 AAACCCTGCCCTAGAGCCTAAGG - Intergenic
1118404943 14:65413249-65413271 CAGCCCAGCCCAAGACCCCGAGG - Intronic
1119548547 14:75491500-75491522 AGCCCCTGCCCTAGATCCCACGG - Intergenic
1120176088 14:81294819-81294841 AATCCCTGCCCTAGTTCACAGGG + Intronic
1121622667 14:95361146-95361168 ACGCCCAGCCCTGGATCCCAGGG + Intergenic
1122011349 14:98751551-98751573 AGGCCCTGCCCTAGATCTCTAGG + Intergenic
1122275308 14:100587841-100587863 CAGCCCTGCTGTAGGCCCCAGGG + Intergenic
1122790589 14:104182682-104182704 CAGCACTGTCCTGGATCCCATGG - Intergenic
1129230048 15:74192094-74192116 CACTCCTGCCCGGGATCCCAGGG - Intronic
1129329770 15:74821054-74821076 CAGCTCTGCCCTAATCCCCAGGG + Exonic
1129407465 15:75328805-75328827 CAGCCCAACACCAGATCCCAGGG - Intergenic
1129734353 15:77951540-77951562 CAGCCCAGCACCAGATCCCAGGG + Intergenic
1129841233 15:78744451-78744473 CAGCCCAGCACCAGATCCCAGGG - Intergenic
1130106828 15:80935071-80935093 CAGCCCTGCTCAAGAGCCCTGGG + Intronic
1130196427 15:81784063-81784085 CCGCCCTCTCCTAGATCCTAGGG - Intergenic
1131071981 15:89471721-89471743 CTGCCCTCCCCTTCATCCCAGGG - Exonic
1131153637 15:90062054-90062076 CAGGACTGCCCTATTTCCCAGGG - Intronic
1132758458 16:1497235-1497257 CAGCTGAGCCCCAGATCCCACGG - Intronic
1132827038 16:1910270-1910292 CAGCCCTGCCCAGCCTCCCAGGG + Intergenic
1132852957 16:2033068-2033090 CTGCCCTGCCCCAGGACCCAGGG - Intronic
1133221699 16:4321675-4321697 GACCCCTGCCCCAGTTCCCACGG - Intronic
1134675849 16:16090124-16090146 GACCCCTGCCCCAGATTCCAGGG - Intronic
1136500291 16:30666717-30666739 CTGCCTTGCCCAAGGTCCCATGG - Intronic
1137761593 16:50945254-50945276 CAGTGCTGCCCTAGTTCTCAAGG - Intergenic
1138555911 16:57771135-57771157 TAGCCCTGCCCCAGGTGCCAGGG + Intronic
1139491419 16:67288104-67288126 TAGCCTGGCCCCAGATCCCAAGG - Intronic
1140536461 16:75714402-75714424 CACTGCTTCCCTAGATCCCAAGG + Intronic
1141737231 16:85861689-85861711 CTGCCCACCCATAGATCCCATGG - Intergenic
1142406445 16:89892905-89892927 CAGCGCTGCCATGGCTCCCACGG + Intronic
1143183177 17:4996781-4996803 CAGCCCATCCCTAGTTCCCTTGG - Intronic
1143669286 17:8385319-8385341 CAGCTCAGCCCTAGAGCCCCTGG - Intergenic
1144256670 17:13475237-13475259 CATCCCTGCACTAGAGCTCAGGG - Intergenic
1144626550 17:16846959-16846981 AAGCCCCGCCCTGGATCCCAGGG + Intergenic
1144879881 17:18425752-18425774 AAGCCCCGCCCTGGGTCCCAGGG - Intergenic
1145152352 17:20518632-20518654 AAGCCCCGCCCTGGGTCCCAGGG + Intergenic
1146001035 17:29130677-29130699 CAGCTCTGCCCCAGAGCCCTGGG + Intronic
1146658879 17:34651545-34651567 CAGCCCTGCGCTGGGGCCCAGGG - Intergenic
1147419731 17:40316598-40316620 CAGCCCGCCCCTAGTGCCCACGG - Intronic
1147580693 17:41625646-41625668 AAGCCCGGCCCTGGGTCCCAGGG + Intergenic
1148444157 17:47727586-47727608 CAGGCCTGGCCTGGAGCCCAGGG + Intergenic
1148524415 17:48317009-48317031 CAGCCCTGCCCATGATCCAGGGG - Intronic
1148687210 17:49507561-49507583 CAGCTCTGCCCTGGCTCCCACGG - Intronic
1151335101 17:73435105-73435127 CAGCCCTGCCTGGGAACCCAGGG + Intronic
1151725038 17:75878628-75878650 GAGCCCTGGCCTAGGTCCCAGGG - Intergenic
1151975526 17:77481823-77481845 CAGCCCTGCCTTGGAGCGCAGGG + Intronic
1152294828 17:79460800-79460822 CAGACCTGCACCAGATGCCAGGG + Intronic
1156525643 18:37765040-37765062 CAGCCCAGCCCTGGCCCCCACGG - Intergenic
1157069535 18:44389982-44390004 CAGGCCTGCTCTAGATCACCAGG + Intergenic
1157596961 18:48869883-48869905 CAGCCCTGCCCCAGAACCCTGGG + Intergenic
1157614686 18:48979488-48979510 CAGCCCTGCCCCAGGACCCTGGG - Intergenic
1158241746 18:55385831-55385853 CAGCCCTGCTCAAGTTCTCAGGG + Intronic
1160742792 19:695154-695176 CAGCCCAGCCCTGGATCTCCCGG - Intronic
1161162443 19:2768782-2768804 CAGCTCGGCCCTGGCTCCCACGG + Intronic
1161977936 19:7616407-7616429 CAGTCCTGCCCAAGACCCCTCGG - Intronic
1162349104 19:10138115-10138137 CAGCACTGCCCGAGGTCACATGG + Intronic
1162609554 19:11738665-11738687 CAGCTCTGCCCTTGGTCCCCTGG - Intronic
1163207770 19:15815959-15815981 CAGCCCTGCCATTGCCCCCAGGG + Intergenic
1163721663 19:18900803-18900825 CACCCCTGCACCAGCTCCCAAGG + Intronic
1164630389 19:29758069-29758091 AAGCCCTGCCCTAGGCCCCAGGG + Intergenic
1164713128 19:30373325-30373347 CAGCCCTGCCTTACCTCACAGGG - Intronic
1164722194 19:30440515-30440537 CAGCTCTGCCTTAGGACCCAAGG + Intronic
1164872636 19:31658822-31658844 CAGCCCTTCCCTAGACCCCCAGG - Intergenic
1165074618 19:33273853-33273875 CAGCCCTGCCCCAGGGGCCATGG + Intergenic
1165978837 19:39702430-39702452 CAGCACTGCCCTTGATCCTCAGG - Intergenic
1166801891 19:45462917-45462939 CATCTCTGCCCTGGCTCCCAAGG - Intronic
1166855157 19:45779664-45779686 CAGCCCAGCCCTAGGTTCTAAGG + Intronic
1166920620 19:46226822-46226844 CAGCCCTGCCCGGGAGCCCTGGG + Intergenic
1167207248 19:48110848-48110870 CAGCCCTCCACGTGATCCCACGG - Intergenic
1168354377 19:55692425-55692447 CAGCCCTCCCTCAGCTCCCACGG - Intronic
926325819 2:11784574-11784596 CAGCCCTGCCCTAGATCGCAGGG - Intronic
926418722 2:12676056-12676078 AAGCTCTGCCCTGGATACCATGG - Intergenic
926793984 2:16603698-16603720 CAGCCCTGCCCTAGAAGACAGGG - Intronic
930658143 2:54027367-54027389 CTGTCCTGCCCTGTATCCCAGGG + Intronic
931583588 2:63804126-63804148 CACCCCTGCTCTAGATACGAAGG - Intronic
931642207 2:64391965-64391987 CAGCCCTGCCCTGGAGCTCTGGG - Intergenic
932438956 2:71719738-71719760 CAGGCCTGCCCCAGAGCCCCTGG + Intergenic
934562926 2:95322585-95322607 CAGCCCTGCCCTTGTGGCCAGGG - Intronic
934904654 2:98188105-98188127 CAGCCCTGGCCCGGATCCGAAGG + Exonic
937067566 2:119029427-119029449 CAGCCCTGGGCTAGGACCCATGG - Intergenic
939508952 2:143083022-143083044 CAGGGCTAGCCTAGATCCCAAGG + Intergenic
940038456 2:149333631-149333653 CAGCTCTGCTCTAGATGCTAGGG + Intronic
944150567 2:196554008-196554030 CAGCCCTATCCTAGATATCAGGG - Intronic
944294046 2:198042044-198042066 CAGAGCTGCCCTAGCTCCAAAGG - Intronic
944391494 2:199224322-199224344 CAGCCCTGCAGTAGGTCTCATGG - Intergenic
944635883 2:201675713-201675735 AAGCCTTGCCCTGGAGCCCAGGG - Intronic
945182355 2:207104967-207104989 CTACCCTCCCCTAGAACCCATGG + Intronic
946069085 2:217015613-217015635 CAGGCCTGCGTTTGATCCCAGGG + Intergenic
946517501 2:220429387-220429409 CAGCCCTGACCTGGTTCCCCAGG - Intergenic
947535194 2:230935646-230935668 CAGCCCAGTCCCAGAGCCCAGGG - Intronic
948831560 2:240600872-240600894 CGGAGCTGCCCTAGATCCCTGGG + Intronic
1169075171 20:2755788-2755810 CAGGCCTGCCCCAGAGCCCACGG + Exonic
1169207758 20:3749646-3749668 CAGCCCTGCCCCGGGTCCCAAGG - Intronic
1171475838 20:25407938-25407960 CCGCCCCGCCCCAGAGCCCAGGG - Intronic
1171983637 20:31644525-31644547 CAGCTTTGCCTTAGACCCCAAGG - Intronic
1172466604 20:35160157-35160179 CAACCCTTCCCTAAACCCCAAGG - Intergenic
1173676346 20:44838975-44838997 CAGCCCCGCCCTCGTTCTCATGG + Intergenic
1175337939 20:58208315-58208337 CAGCCCTTCCCTGCATGCCACGG + Intergenic
1175410091 20:58762100-58762122 CAACCCTGCCCGAGATCCAAGGG - Intergenic
1175624981 20:60482523-60482545 CTCTCCTGCCCTCGATCCCATGG + Intergenic
1175886809 20:62296883-62296905 CTGCCCTGCCCTAGTGTCCAAGG + Intergenic
1176048417 20:63104187-63104209 CAGCCCCGTCCCTGATCCCAGGG - Intergenic
1176058391 20:63160912-63160934 CAGTTCTGGCCCAGATCCCAAGG - Intergenic
1178445162 21:32633284-32633306 CACTCCTGCCCTAAATCCCTTGG + Intronic
1178487094 21:33026048-33026070 CAGCCGCAGCCTAGATCCCAGGG + Exonic
1179481373 21:41680929-41680951 GAGCCTTGCCCTAGATTCCGTGG + Intergenic
1179591790 21:42413878-42413900 CAGCCCTGGCCTGGAGACCAAGG + Intronic
1180732129 22:17990008-17990030 CGCCCCTGCCCTAAAACCCAGGG + Intronic
1180790246 22:18571940-18571962 CAGCCCTGTCCGGGACCCCATGG - Intergenic
1181231492 22:21423375-21423397 CAGCCCTGTCCGGGACCCCATGG + Intronic
1181247159 22:21511493-21511515 CAGCCCTGTCCGGGACCCCATGG - Intergenic
1181417156 22:22768515-22768537 CAGCCCTTCCCTAGTTCACCTGG - Intronic
1181512740 22:23396080-23396102 CAGCCCTGCCCCAGGGTCCATGG + Intergenic
1182962482 22:34488628-34488650 CAGCCCTGCACTGCAGCCCAAGG + Intergenic
1183705120 22:39471173-39471195 CTGCCCTGCCCTGGCTTCCAAGG - Intronic
1183979233 22:41530054-41530076 CAGCCCTACCCTTAATCTCAGGG + Intronic
1184058479 22:42067729-42067751 CAGCCCTGCCCTTGGCCTCAGGG - Intronic
1184272927 22:43395168-43395190 CAGGCCTCCCCTAGGTGCCATGG + Intergenic
1184676574 22:46046181-46046203 CAGCCCTGCCAGAGAGTCCAGGG - Intergenic
949578779 3:5365644-5365666 AACCCCTACCCTAGATCACATGG - Intergenic
950329628 3:12146019-12146041 CAGCCCTCCCCCATGTCCCAGGG - Intronic
950443080 3:13021190-13021212 CAGCCTTGCCTGAGATCACAAGG + Intronic
952012435 3:28915880-28915902 GATCCCTGACCTAGTTCCCATGG + Intergenic
952902198 3:38117729-38117751 CAGCCCTACCCTAGAGCCATGGG + Intronic
953030411 3:39176261-39176283 CAGCCCTGCTGTATCTCCCATGG + Intergenic
953880686 3:46689901-46689923 CAGCCCTGTCCTCTAGCCCATGG + Intronic
954610469 3:51942285-51942307 CAGCCCGGCGCTAGACCCAACGG + Intergenic
954863466 3:53709620-53709642 CAACCCTCCCCTAGAGCACAGGG + Intronic
955523026 3:59793470-59793492 CAGCCTTGCCCAAGGTCACATGG + Intronic
961165928 3:124763854-124763876 CAGAGCTGTCCTAGAGCCCACGG - Intronic
961536332 3:127573196-127573218 CAGCCCTGCCCTCGTGCCAAGGG + Exonic
961683099 3:128611953-128611975 CAGCTCTACCCGAGAGCCCAGGG - Intergenic
962607426 3:137044394-137044416 CAGCCTTGCCCTGGAACCCTGGG - Intergenic
963371254 3:144403399-144403421 GAGACCTGCCCTAGATCTCAGGG + Intergenic
963480709 3:145869926-145869948 CAGCACTGCTCTATATCTCAGGG - Intergenic
964727170 3:159825563-159825585 CACTCCTGCCCTCGATCCCAAGG + Intronic
964744983 3:160003783-160003805 CAGCCCTGCCTTAAGTACCAGGG + Intergenic
965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG + Intronic
966164112 3:176997915-176997937 CAGACCTGCCCCAAAGCCCAAGG + Intergenic
968451684 4:678936-678958 CAGCCCTGACCTTGGTCCCCAGG + Exonic
968764507 4:2461256-2461278 GGGCCCTGGCCTAGTTCCCAGGG + Intronic
968802195 4:2750564-2750586 CAGCCTTGACCTCGAGCCCATGG - Intronic
969417336 4:7069127-7069149 CTGCCCTCCCCGGGATCCCAGGG + Intergenic
969444925 4:7239294-7239316 CAGCCCTGCCCCAGATCCCTCGG - Intronic
969990102 4:11253374-11253396 CAGCTCTGCTCTAAATACCATGG + Intergenic
973262747 4:48181350-48181372 CAGCCCTGCCTAACCTCCCAGGG - Intronic
980815683 4:137942888-137942910 AATCCCTGCCCTAGATACAAAGG - Intergenic
984311620 4:178067973-178067995 CATCCCTGCCCCCCATCCCATGG - Intergenic
984887360 4:184461952-184461974 CAGTCCTGCCCCACATCCCCAGG + Intronic
985671344 5:1208578-1208600 CAGCTCTGGCCCTGATCCCATGG + Intronic
985821973 5:2166628-2166650 CACCACTGCCCCAGCTCCCAGGG + Intergenic
986214049 5:5701414-5701436 CAGCCCTCACCTACATCCCAAGG - Intergenic
987379699 5:17273792-17273814 CAGCCTTGCCCTGGACCCCAAGG - Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992029772 5:72709437-72709459 CAGCCCTGCCCAGGATCACAGGG + Intergenic
994051324 5:95365773-95365795 CAGCCCTCACCCAGCTCCCACGG + Intergenic
994322051 5:98405519-98405541 GAGCCTTGTCCTAAATCCCATGG + Intergenic
995071163 5:107923372-107923394 CAGCCATTCCCTAGTTACCAGGG - Intronic
997124774 5:131214746-131214768 CAGGCCTGCCCTCAATGCCAGGG - Intergenic
997500498 5:134370133-134370155 CAGCCTTGCCCCTGATTCCATGG - Intronic
998092895 5:139381306-139381328 CAGCCCTGAGCTAGCTCCCAGGG - Intronic
998095830 5:139395037-139395059 CAGCCCTGCCTGGGATCCCGAGG - Exonic
998168188 5:139856331-139856353 CAGCACTTTCCTAGATGCCAGGG - Intronic
999081837 5:148851677-148851699 CAGCTCTGCTCAACATCCCAGGG - Intergenic
999736618 5:154517818-154517840 CCACCCTGCCATAGATGCCAGGG + Intergenic
1001195555 5:169670276-169670298 CACCATAGCCCTAGATCCCAAGG - Intronic
1001433486 5:171681709-171681731 CAGCCCTGCCCCTGAGGCCATGG - Intergenic
1001560117 5:172663544-172663566 CAGCCCTGGCCCAAATCCCATGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1001695776 5:173668614-173668636 CAGCCCTGTCTCAGAGCCCAGGG - Intergenic
1002165178 5:177339443-177339465 CATCCCTGCCCCAGCTCACATGG - Intronic
1002353619 5:178604790-178604812 GACCCCTGCACTAGATCACAAGG + Intronic
1003075817 6:2982952-2982974 CAGCCCTACCCTACCTCCCTGGG - Intergenic
1003113165 6:3265574-3265596 ACACCCTGCCCTATATCCCAGGG - Intronic
1003858949 6:10304310-10304332 AAGCCCTGCCCGAGTTCTCATGG - Intergenic
1003873505 6:10418976-10418998 CGGCCTCGCCCTAGACCCCAGGG - Intronic
1004071391 6:12301093-12301115 CACCCCTGTCCCAGATCACAAGG - Intergenic
1005471583 6:26166520-26166542 CAGCCTTCCCCCACATCCCAAGG - Intronic
1005959115 6:30683868-30683890 CAGCTCTGCCCTCCTTCCCACGG + Intronic
1007633060 6:43283430-43283452 CAGCCCTGCCCCAGGCCCCGGGG - Exonic
1008381097 6:50840582-50840604 CAGCTCTTCCCTGGATCCGAAGG + Intronic
1009332862 6:62445631-62445653 CAGCCCTGCCCCTGGCCCCATGG - Intergenic
1013141335 6:107338667-107338689 CGTCCCTGCCCCAGATCCCCTGG - Intronic
1018340908 6:162850480-162850502 CAGCCCTACCCCTGAACCCAGGG + Intronic
1018492943 6:164315432-164315454 CAGCTATGCCCTAGAGCACAAGG - Intergenic
1020109467 7:5439942-5439964 CAGCCCTGCCCTTGAGCCCTAGG - Intronic
1021496184 7:21276857-21276879 GAGACTTGCCCGAGATCCCAAGG + Intergenic
1024174742 7:46827610-46827632 CAGCCCTCACCTAGCTCCCACGG - Intergenic
1024685272 7:51737789-51737811 CACCCCTGCCCCAGTTCCGAGGG - Intergenic
1026881486 7:73909272-73909294 CAGCCCTGCCCTGGAAGCCCAGG + Intergenic
1028753859 7:94412589-94412611 CAGGCCTGCCGTCGATGCCAGGG - Exonic
1029458226 7:100681678-100681700 CTGCCCTGGCCTACAGCCCAGGG + Exonic
1030151869 7:106414738-106414760 CAGCCCTGCTCTAGACCTTAAGG + Intergenic
1032931549 7:136678068-136678090 CAGCCTTGCCATAGATCACCTGG - Intergenic
1034210173 7:149356465-149356487 CAGCACTGCCTTAGAGACCAAGG - Intergenic
1034326214 7:150236395-150236417 CAGAATTGCCCTAGATGCCAAGG - Intergenic
1034766991 7:153732861-153732883 CAGAATTGCCCTAGATGCCAAGG + Intergenic
1034982020 7:155485176-155485198 CAGCCCTGCTCTGGATACCTTGG - Intronic
1035397871 7:158546898-158546920 CAGCCCTGCCCCAGGTGCCCAGG - Intronic
1036665874 8:10737863-10737885 CAGTCAAGCCCTAAATCCCATGG - Intronic
1036774006 8:11597656-11597678 TCCCCCTGCCCTGGATCCCAAGG + Intergenic
1037705597 8:21313354-21313376 CAGCCCCGGACTGGATCCCAGGG - Intergenic
1039079054 8:33718057-33718079 CAGCCCTCCCCTCCATCCCAAGG - Intergenic
1042700089 8:71602689-71602711 CTGCCCTTCCCTAAATTCCAGGG - Intergenic
1043616026 8:82126671-82126693 CTTCCCTGCCCTAGCTCCTAGGG - Intergenic
1049429099 8:142550955-142550977 CTTCCCTGCCCTGGTTCCCAAGG - Intergenic
1049444782 8:142624912-142624934 CAGCCCCGCCCCTCATCCCAGGG + Intergenic
1049921899 9:372668-372690 CAGCCCTCCGGTAGATACCAAGG + Intronic
1050924171 9:11241929-11241951 CAGCCTTGCACTAGCTGCCAAGG - Intergenic
1052325921 9:27216716-27216738 CAGCCCTGCCCTAGATCCCAAGG - Intronic
1052550175 9:29938092-29938114 CAGGCCTCGCCTAGCTCCCATGG + Intergenic
1053376566 9:37612102-37612124 AAACCCTGACCTATATCCCAGGG + Intronic
1054715674 9:68555843-68555865 AAGCCCTGGCCTAGATGGCAAGG - Intergenic
1056423968 9:86457723-86457745 CCTCCCTGGCCTACATCCCAGGG - Intergenic
1060757175 9:126222623-126222645 CAGCCCCACCCTAGACCCCAGGG + Intergenic
1061101276 9:128494406-128494428 CAGCCCTGCCCTAACTCTAAAGG + Intronic
1062248610 9:135583223-135583245 CAGCCCATCCCTGGGTCCCATGG + Intergenic
1062320780 9:135989664-135989686 CAGCCCTGCACTGGCGCCCAAGG - Intergenic
1062381900 9:136290730-136290752 CGGCCCTGCCCCAGGTCCCGGGG - Exonic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1188598187 X:31926896-31926918 CAGCCCTACCCTTCATCCAAAGG - Intronic
1188896517 X:35675565-35675587 CAACCCAGCCCTAGATCAAAAGG + Intergenic
1190255871 X:48761869-48761891 CACCCTTGCCCCAGATCCCCAGG - Intronic
1195272168 X:103242705-103242727 CAGCCCTTCCCTCCATCCCAAGG + Intergenic
1195323933 X:103743025-103743047 CAGCCTGGCCCCAGAGCCCATGG + Intergenic
1196630008 X:117927281-117927303 CCGGCCTGGCCTGGATCCCAAGG + Intronic
1198392334 X:136188806-136188828 CAGCAATGCCCAAGGTCCCAGGG - Intronic
1199941519 X:152632385-152632407 CATCCCTGCCCCTGTTCCCAAGG - Intergenic
1200153009 X:153960406-153960428 CTGCCCTCCCCCAGATACCATGG - Exonic
1200918643 Y:8593475-8593497 CTGCCCTGTCCTAGATTCAAGGG - Intergenic