ID: 1052327674

View in Genome Browser
Species Human (GRCh38)
Location 9:27233020-27233042
Sequence AGGTATACACAGAGTTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052327674_1052327675 -7 Left 1052327674 9:27233020-27233042 CCATGCTAACTCTGTGTATACCT No data
Right 1052327675 9:27233036-27233058 TATACCTGTGCTTCCATTCTTGG No data
1052327674_1052327677 1 Left 1052327674 9:27233020-27233042 CCATGCTAACTCTGTGTATACCT No data
Right 1052327677 9:27233044-27233066 TGCTTCCATTCTTGGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052327674 Original CRISPR AGGTATACACAGAGTTAGCA TGG (reversed) Intergenic
No off target data available for this crispr