ID: 1052331020

View in Genome Browser
Species Human (GRCh38)
Location 9:27268476-27268498
Sequence CAATATATGAAAGGTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052331020_1052331023 1 Left 1052331020 9:27268476-27268498 CCTGCTACACCTTTCATATATTG 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1052331023 9:27268500-27268522 CTTTTTTTCTATTTTAGCCTAGG 0: 1
1: 0
2: 7
3: 131
4: 1461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052331020 Original CRISPR CAATATATGAAAGGTGTAGC AGG (reversed) Intergenic
902751844 1:18520646-18520668 GAATAAAAAAAAGGTGTAGCAGG - Intergenic
907197550 1:52698748-52698770 CTATATGTGCCAGGTGTAGCTGG + Intergenic
909408007 1:75314363-75314385 CAAAATATGAAAGATGATGCTGG - Intronic
918521139 1:185416101-185416123 GAATACATGAAAGTTGTAGTAGG + Intergenic
919030813 1:192239653-192239675 CAAAATATGAAAGCTTTTGCAGG + Intergenic
919071683 1:192763698-192763720 CAATTTATCAAAGATTTAGCAGG + Intergenic
1063767933 10:9163805-9163827 AAAAACATGAAAGATGTAGCTGG + Intergenic
1064781635 10:18845772-18845794 AAATATATGAAAGGAATAGCAGG + Intergenic
1065059445 10:21883534-21883556 CAATATATGATAGGTTTATCAGG - Intronic
1065233398 10:23621914-23621936 ATATATATGAAAGAAGTAGCAGG - Intergenic
1065521598 10:26579357-26579379 CAATGAATGAAAGGTGGGGCAGG + Intergenic
1065522703 10:26588082-26588104 CAATAAATGAAAGGTGGGGCGGG + Intergenic
1065527417 10:26637622-26637644 CAATGAATGAAAGGTGGGGCAGG + Intergenic
1065528640 10:26647354-26647376 CAATGAATGAAAGGTGGGGCGGG + Intergenic
1065558822 10:26942024-26942046 CAATGAATGAAAGGTGGGGCGGG - Intergenic
1065559134 10:26944564-26944586 TAATAAATGAAAGGTGGGGCGGG - Intergenic
1065559414 10:26946767-26946789 CAATGAATGAAAGGTGGGGCAGG - Intergenic
1070005688 10:72422038-72422060 CAACATATGAATGGGGTAGGGGG - Intronic
1070460912 10:76669139-76669161 CACTATAGGAAAGATGTACCTGG - Intergenic
1071250018 10:83808473-83808495 CAACATATGAAAGATGAGGCTGG + Intergenic
1085352037 11:75804306-75804328 CCATATAAGAATGGTGTAGTGGG + Intergenic
1086250565 11:84807650-84807672 AAAAATAGGAAAGGTGTATCAGG + Intronic
1086650180 11:89279046-89279068 CATCATATCAAAGGTGTAGAGGG + Intronic
1092701628 12:11237715-11237737 CAGTATATGAAAAGTATATCTGG - Intergenic
1092841068 12:12541547-12541569 CAATCTATGATAGTTGTAGTTGG + Intronic
1092858907 12:12701767-12701789 CAAAATATGAAAACTTTAGCTGG + Intergenic
1092915760 12:13187665-13187687 CAATATTTGCAAGGTGAACCTGG + Intergenic
1099335797 12:81355512-81355534 CTATATATGAAAGTCCTAGCTGG + Intronic
1099351261 12:81571893-81571915 CAGTATATGAAAGAAGTAGATGG - Intronic
1102451907 12:113048188-113048210 CAACATATGAAAAGGGGAGCGGG + Intergenic
1102799219 12:115717109-115717131 GATTATATGAAAGGGGTGGCAGG - Intergenic
1104085726 12:125472581-125472603 CAACATATGAAAGTTGGAGAAGG - Intronic
1111448777 13:88387197-88387219 CAATATATGTAAGATGTACAAGG + Intergenic
1116100856 14:40433524-40433546 TAATTTATGAAAGCTATAGCTGG + Intergenic
1118914288 14:70088921-70088943 CAATATATGAGAGTTTTAGCAGG - Intronic
1119798538 14:77421907-77421929 CAATATATGAAACTTGCAGGTGG - Intronic
1128877152 15:71211615-71211637 CAATATATGAATGGTGGGGAGGG + Intronic
1129890803 15:79070515-79070537 CAACAAATGACAGGTGTAGGTGG + Intronic
1135190418 16:20349610-20349632 CAAAAAATGAATGGTGGAGCTGG - Intronic
1136389649 16:29955043-29955065 CAAAATATGCAAAGTGTGGCTGG - Intronic
1138320538 16:56107438-56107460 ACATATATGACAGGAGTAGCAGG + Intergenic
1140487494 16:75305192-75305214 GAAAATATGAAAGATGTAGCAGG + Intronic
1141279113 16:82614685-82614707 CAATATCTGAAAGGTTGGGCAGG - Intergenic
1146449783 17:32963869-32963891 CAATATAGGAATGGTGCAGTAGG + Intergenic
1153691404 18:7597615-7597637 CAATACATGAATGGAGAAGCAGG - Intronic
1157970336 18:52260217-52260239 CAATTTATAAAAATTGTAGCAGG + Intergenic
1158146386 18:54318376-54318398 CAATATATGAAAGATATTTCTGG + Intronic
1161406802 19:4095374-4095396 CAATAAATGGTAGGTGGAGCCGG - Exonic
1168040729 19:53756490-53756512 AAATATAAGATATGTGTAGCAGG + Intergenic
1168595352 19:57671182-57671204 CATTATATGAAATATGTAGCTGG + Intronic
925035116 2:679067-679089 CAATATATGAAAGATCTGGGAGG - Intergenic
926576304 2:14586000-14586022 CAATATTTGAATGATGTGGCAGG - Intergenic
927667040 2:25040104-25040126 CAAAGAATGAAAGGTCTAGCAGG - Intergenic
928527475 2:32156717-32156739 CAATATATTAAAAGTTGAGCTGG - Exonic
928604830 2:32936025-32936047 CAATACAGGTAAGGTGTAGATGG - Intergenic
929226531 2:39516686-39516708 CAATATGTGAAAAGCTTAGCCGG + Intergenic
931003248 2:57814802-57814824 CAAAATAGGATTGGTGTAGCTGG - Intergenic
931561230 2:63563479-63563501 ATATATATGAAATGTGTAGATGG + Intronic
932500622 2:72179881-72179903 TAATATTTGAAAGGTAAAGCAGG + Intronic
932640753 2:73443498-73443520 CAACATATGTAAGGAGTATCTGG - Intronic
934742181 2:96732347-96732369 CAATATAAGAAAGCAATAGCCGG + Intronic
937621207 2:123989611-123989633 CAATATATGAGAATTCTAGCTGG - Intergenic
942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG + Intronic
943514884 2:188872498-188872520 CAATATATGACAGTTGTACCTGG + Intergenic
944204236 2:197140615-197140637 CAATATTTAAAATGTCTAGCTGG - Intronic
944329343 2:198446833-198446855 CAATATATAAAATCTGCAGCTGG + Intronic
1171725778 20:28620072-28620094 CAATAAATGAAAGGTGGGGCGGG + Intergenic
1171789979 20:29514569-29514591 CAATAAATGAAAGGTGGGGTGGG + Intergenic
1171857735 20:30362286-30362308 CAATAAATGAAAGGTGGGGCGGG - Intergenic
1172894490 20:38290883-38290905 CAAGCTATAAAAGGTGTTGCAGG + Intronic
1174853358 20:54018634-54018656 CAATATATAAAAGGGGTGGGAGG - Intronic
1177608545 21:23415000-23415022 CAATAAAAGAAACGTGTAGGAGG + Intergenic
1180390678 22:12279679-12279701 CAATAAATGAAAGGTGGGGCGGG + Intergenic
1180409065 22:12585078-12585100 CAATAAATGAAAGGTGGGGCGGG - Intergenic
949973540 3:9433284-9433306 TAATATTTGAAAGGTGTTGGGGG + Intronic
953587036 3:44211381-44211403 CAAAATATGAAAGTTATTGCTGG + Intergenic
955517349 3:59739989-59740011 CAATAAACAAAAGGTGTAGAAGG - Intergenic
955589318 3:60517346-60517368 GAATATGTGAAAGGTATAGTAGG - Intronic
955908662 3:63835031-63835053 CAATTTCTGAACAGTGTAGCTGG - Intronic
956063615 3:65373959-65373981 CAAGATTTGAAAGGTATAGCCGG - Intronic
958724241 3:97884543-97884565 ATATATTTGAAAAGTGTAGCAGG + Intronic
960129992 3:114045531-114045553 AAATATATGAAGGATTTAGCAGG - Intronic
965308637 3:167100227-167100249 CAATATATGAAACGGGTGGTGGG + Intergenic
967369035 3:188721947-188721969 CAATATATGAAAAGTGTTTGAGG - Intronic
967629409 3:191727256-191727278 GAAGATATGAAATTTGTAGCAGG + Intergenic
971894906 4:32579824-32579846 CAAAATATCAAAGTGGTAGCTGG + Intergenic
973969740 4:56200599-56200621 GAATATATAAAAGCTATAGCAGG - Intronic
976950238 4:90819326-90819348 CAATACATGAATTGTGGAGCAGG + Intronic
977901079 4:102423026-102423048 AAATATAGGAAAGGCATAGCTGG - Intronic
978597551 4:110394451-110394473 CAATACATGAAAGGTATACATGG - Intronic
980391159 4:132148884-132148906 TGATATATGAATGGTGTATCTGG + Intergenic
981092395 4:140745109-140745131 CAGTATATGTAAGGTGTAATTGG - Intronic
981749417 4:148079473-148079495 CAAAATCTAAAAGCTGTAGCTGG - Exonic
982333366 4:154207157-154207179 TAAAATGTGACAGGTGTAGCTGG - Intergenic
982557468 4:156886086-156886108 CAAAATATAAAAGGCTTAGCAGG + Intronic
982901381 4:161007847-161007869 TAATAGTTGAAAGGTGTGGCAGG + Intergenic
983798606 4:171898707-171898729 CAAAATATAAAAGGTGTTGTAGG + Intronic
986997329 5:13621999-13622021 GAATATATGAAAAGTCTATCTGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
990485041 5:56249868-56249890 AAATGTATGAAAGCTGTAACTGG - Intergenic
990654222 5:57936364-57936386 AAATAAATGAAATGTGTAGTAGG - Intergenic
993985651 5:94594315-94594337 CAATATAATAAAGGTATTGCTGG + Intronic
995287389 5:110406414-110406436 CCATATATTAAAGGTATATCTGG - Intronic
996035146 5:118750490-118750512 CAATATATGACAAGAGAAGCAGG + Intergenic
999599120 5:153241095-153241117 CAGAATATGTAAAGTGTAGCTGG - Intergenic
1000166229 5:158651230-158651252 CAATATATGAATGGGGTGGGAGG + Intergenic
1003694852 6:8394195-8394217 CAAGATATGAAAGGTAAAACAGG - Intergenic
1004083771 6:12423209-12423231 CAATGTCTGAAGGGTGTACCTGG + Intergenic
1005720311 6:28595036-28595058 CAAGTTATGAAATGTGTACCTGG + Intronic
1012033635 6:94104098-94104120 CAAGAAATGAGAGATGTAGCAGG + Intergenic
1014082761 6:117306647-117306669 CAGTAAATGGAAGGTGTAGCAGG + Intronic
1015069322 6:129071574-129071596 CAATATATCAAACTTGTAGGAGG - Intronic
1016892135 6:149017079-149017101 CAATAAATGTAAGATGCAGCCGG + Intronic
1021761824 7:23909816-23909838 CCATATAGTCAAGGTGTAGCAGG - Intergenic
1024814214 7:53249024-53249046 CAATTTATTAAAGATGTAACAGG + Intergenic
1024905387 7:54373554-54373576 CAATGTTTGAAAGGTAAAGCAGG - Intergenic
1026102337 7:67393482-67393504 CAACAGATGGAAGGTGTAGGTGG + Intergenic
1027588186 7:80084307-80084329 CAATAAATTAAAGGGGTGGCGGG + Intergenic
1028649907 7:93139859-93139881 CAATAGATCAAAGGTGTTGGTGG - Intronic
1029804936 7:102986265-102986287 CAATCTATGAAAAATGTTGCTGG + Intronic
1034523032 7:151635443-151635465 CAATGGATGAATGGTGAAGCGGG + Intronic
1036475560 8:9089817-9089839 GAAGAAATGAAAGGTGTGGCAGG + Intronic
1040972168 8:53147671-53147693 TAATAAATGAAAGGTTTAGCCGG + Intergenic
1041517097 8:58712623-58712645 CAATTTATGATAGGTTTATCAGG - Intergenic
1042427507 8:68665416-68665438 CAATACAGGAAAGCTGCAGCTGG - Intronic
1043035222 8:75189003-75189025 GAATATATGAAATGTATATCTGG + Intergenic
1043324207 8:79029840-79029862 CAATATATTTTAGGTGTAGGTGG + Intergenic
1044047236 8:87451107-87451129 CAAAATACGACAGGTGTACCAGG - Intronic
1046777390 8:118178760-118178782 CAATATAAGAAATGTGTGGCCGG - Intergenic
1047682168 8:127265368-127265390 CAATATATGTTAGATGAAGCAGG - Intergenic
1052026832 9:23582784-23582806 CAAGATATGGAAGGGGTAGAGGG + Intergenic
1052145056 9:25038557-25038579 GAAGAAATGAAAGATGTAGCTGG - Intergenic
1052171509 9:25403395-25403417 CATTATATAAAAACTGTAGCAGG - Intergenic
1052331020 9:27268476-27268498 CAATATATGAAAGGTGTAGCAGG - Intergenic
1053723833 9:40975796-40975818 CAATAAATGAAAGGTGGGGCGGG - Intergenic
1054342127 9:63876203-63876225 CAATAAATGAAAGGTGGGGCGGG + Intergenic
1057981492 9:99668494-99668516 CAATATATGTAAGGTATACATGG + Intergenic
1059189429 9:112310046-112310068 CAGTAGATGAAAGGTGTTGATGG - Intronic
1059659858 9:116390234-116390256 CAATAAATGAAAGGTCCAGAAGG + Intronic
1203451330 Un_GL000219v1:120202-120224 CAATAAATGAAAGGTGGGGCGGG + Intergenic
1188182035 X:27067707-27067729 CAGTATATGACAAGTGTGGCTGG + Intergenic
1189799908 X:44682573-44682595 CAATGTATGAAAGGTGGGGTGGG - Intergenic
1195832351 X:109072737-109072759 CATTATTTTAAAGGTGTATCTGG - Intergenic
1197364130 X:125543638-125543660 GAATATATGAAAGATGAACCTGG + Intergenic
1198871384 X:141179897-141179919 CTGGATATGAAAGGTGAAGCTGG - Intergenic
1199822753 X:151465587-151465609 CAATATATTGAAGGTGAAACAGG - Intergenic