ID: 1052334397

View in Genome Browser
Species Human (GRCh38)
Location 9:27304961-27304983
Sequence GCTTATGTATATGCACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052334397_1052334399 6 Left 1052334397 9:27304961-27304983 CCCTCATGTGCATATACATAAGC No data
Right 1052334399 9:27304990-27305012 TCTCAACTTTCCAGTCTCCCAGG No data
1052334397_1052334404 28 Left 1052334397 9:27304961-27304983 CCCTCATGTGCATATACATAAGC No data
Right 1052334404 9:27305012-27305034 GCTGGAAGATAAAGTATCATAGG No data
1052334397_1052334400 10 Left 1052334397 9:27304961-27304983 CCCTCATGTGCATATACATAAGC No data
Right 1052334400 9:27304994-27305016 AACTTTCCAGTCTCCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052334397 Original CRISPR GCTTATGTATATGCACATGA GGG (reversed) Intergenic
No off target data available for this crispr