ID: 1052334399

View in Genome Browser
Species Human (GRCh38)
Location 9:27304990-27305012
Sequence TCTCAACTTTCCAGTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052334395_1052334399 22 Left 1052334395 9:27304945-27304967 CCCTTTTCTGGCTCTTCCCTCAT No data
Right 1052334399 9:27304990-27305012 TCTCAACTTTCCAGTCTCCCAGG No data
1052334397_1052334399 6 Left 1052334397 9:27304961-27304983 CCCTCATGTGCATATACATAAGC No data
Right 1052334399 9:27304990-27305012 TCTCAACTTTCCAGTCTCCCAGG No data
1052334398_1052334399 5 Left 1052334398 9:27304962-27304984 CCTCATGTGCATATACATAAGCT No data
Right 1052334399 9:27304990-27305012 TCTCAACTTTCCAGTCTCCCAGG No data
1052334396_1052334399 21 Left 1052334396 9:27304946-27304968 CCTTTTCTGGCTCTTCCCTCATG No data
Right 1052334399 9:27304990-27305012 TCTCAACTTTCCAGTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052334399 Original CRISPR TCTCAACTTTCCAGTCTCCC AGG Intergenic
No off target data available for this crispr