ID: 1052335249

View in Genome Browser
Species Human (GRCh38)
Location 9:27312590-27312612
Sequence TTTTTGTAGTCGTCCATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052335249_1052335257 30 Left 1052335249 9:27312590-27312612 CCCTCAATGGACGACTACAAAAA No data
Right 1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG No data
1052335249_1052335255 20 Left 1052335249 9:27312590-27312612 CCCTCAATGGACGACTACAAAAA No data
Right 1052335255 9:27312633-27312655 CAAGTACCAAGCACGGTGCTTGG No data
1052335249_1052335254 13 Left 1052335249 9:27312590-27312612 CCCTCAATGGACGACTACAAAAA No data
Right 1052335254 9:27312626-27312648 TACACGTCAAGTACCAAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052335249 Original CRISPR TTTTTGTAGTCGTCCATTGA GGG (reversed) Intergenic
No off target data available for this crispr