ID: 1052335250

View in Genome Browser
Species Human (GRCh38)
Location 9:27312591-27312613
Sequence ATTTTTGTAGTCGTCCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052335250_1052335257 29 Left 1052335250 9:27312591-27312613 CCTCAATGGACGACTACAAAAAT No data
Right 1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG No data
1052335250_1052335254 12 Left 1052335250 9:27312591-27312613 CCTCAATGGACGACTACAAAAAT No data
Right 1052335254 9:27312626-27312648 TACACGTCAAGTACCAAGCACGG No data
1052335250_1052335255 19 Left 1052335250 9:27312591-27312613 CCTCAATGGACGACTACAAAAAT No data
Right 1052335255 9:27312633-27312655 CAAGTACCAAGCACGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052335250 Original CRISPR ATTTTTGTAGTCGTCCATTG AGG (reversed) Intergenic
No off target data available for this crispr