ID: 1052335257

View in Genome Browser
Species Human (GRCh38)
Location 9:27312643-27312665
Sequence GCACGGTGCTTGGCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052335249_1052335257 30 Left 1052335249 9:27312590-27312612 CCCTCAATGGACGACTACAAAAA No data
Right 1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG No data
1052335250_1052335257 29 Left 1052335250 9:27312591-27312613 CCTCAATGGACGACTACAAAAAT No data
Right 1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052335257 Original CRISPR GCACGGTGCTTGGCACAAAC TGG Intergenic
No off target data available for this crispr