ID: 1052336977

View in Genome Browser
Species Human (GRCh38)
Location 9:27330247-27330269
Sequence GAATTCCAGTAAAGCTTAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052336977 Original CRISPR GAATTCCAGTAAAGCTTAGG CGG Exonic
901198098 1:7451530-7451552 GTATTCTGGTAAAGCTCAGGGGG - Intronic
906446477 1:45903854-45903876 GAATTCAAGCACAGCTTAGCTGG - Intronic
910038410 1:82817607-82817629 GGATATCAGTAAAGCTTAAGTGG + Intergenic
918303578 1:183226174-183226196 TAATTCCAGTTGAGATTAGGAGG - Intronic
918427086 1:184421569-184421591 GGTTTCCTGTAAAGCTGAGGTGG - Intronic
920434442 1:205939012-205939034 GTATTCCAGTAAAGCAAGGGAGG - Intronic
920494245 1:206443013-206443035 GAATCCAAGTACAGCTTAGCAGG + Intronic
921011357 1:211145090-211145112 GAATCCAAGTGTAGCTTAGGTGG + Intergenic
924310038 1:242731619-242731641 CCATTCCAGCAAAGCTTGGGTGG + Intergenic
1062873099 10:923531-923553 GAATACCAGTAACCTTTAGGAGG - Intronic
1065173312 10:23053222-23053244 GAATTCCAGTATTGCTGAGTGGG + Intergenic
1068736806 10:60422669-60422691 AAATGCCATTACAGCTTAGGAGG - Intronic
1069105949 10:64383547-64383569 TGGTTCCAGGAAAGCTTAGGGGG + Intergenic
1070243381 10:74706167-74706189 GAATTAGAGGAAAGCTGAGGTGG + Intronic
1071012661 10:80955948-80955970 GAAGAACAGTAGAGCTTAGGTGG - Intergenic
1073370138 10:102980908-102980930 GAATTCCAGCAAAGTGTATGTGG - Intronic
1075464436 10:122641116-122641138 GGGTTCCAGTCAAGCTCAGGAGG + Intronic
1080263893 11:30380947-30380969 GAATACAAGGAAAGATTAGGTGG - Intergenic
1085370246 11:75996643-75996665 CAATTCCAGTAAAGCTTACTGGG + Intronic
1085832030 11:79911863-79911885 GTTTTCCCGTAAACCTTAGGAGG + Intergenic
1086168844 11:83812557-83812579 GATTCCCAGTAAACCTTATGAGG - Intronic
1088744845 11:112796668-112796690 GAGTTCCAGTAAAACTCAGGTGG - Intergenic
1089407780 11:118212806-118212828 GAATTCCAGAAAAGTGTAAGGGG - Intronic
1094196232 12:27752750-27752772 GTATTACAGTAAAAATTAGGTGG + Intronic
1098703688 12:73660973-73660995 GAATTCAGGTAAAGCTTAACTGG + Intergenic
1099782894 12:87222208-87222230 GAATTTCACTATAGCTTAGATGG + Intergenic
1102826979 12:115955927-115955949 GTATTACTGCAAAGCTTAGGAGG - Exonic
1102888093 12:116536710-116536732 GAATTCCATTAAAGCTCCTGGGG + Intergenic
1103170253 12:118812180-118812202 GAATTCCATTCAATCTGAGGAGG + Intergenic
1105989005 13:25599662-25599684 GAATTCCAGGGAAACTTAGCTGG + Intronic
1111416226 13:87948269-87948291 GATTTCCATTAAAGGTTATGTGG - Intergenic
1111483191 13:88859887-88859909 AAATTCCAGAAAAGCTTACTGGG + Intergenic
1115088350 14:29544132-29544154 GAATTCTAGGTAAGCTTAGCAGG + Intergenic
1116651138 14:47594600-47594622 GAATACCAGCAACACTTAGGGGG - Intronic
1117559866 14:56926184-56926206 TAATTCCAGTAAAGCTTTGAAGG + Intergenic
1120011809 14:79424349-79424371 CAATTACTGTAAAGATTAGGAGG - Intronic
1120597862 14:86463510-86463532 GAAAGCCAGTAAATCCTAGGTGG - Intergenic
1121989331 14:98539993-98540015 GAAGCCCAGAAAAACTTAGGTGG + Intergenic
1127433144 15:58931867-58931889 GAATTTCACTAAAAATTAGGAGG + Intronic
1127614782 15:60673353-60673375 GAAATCCTGTTAAGCTTAGGAGG + Intronic
1129360016 15:75018818-75018840 GAGTTTCAGCAAAGCTCAGGAGG + Exonic
1131431530 15:92392898-92392920 TAATTCCAGTAAAACTTAATGGG + Intergenic
1133948046 16:10365813-10365835 GAATGCAGGTACAGCTTAGGTGG + Intronic
1134164252 16:11917075-11917097 GAATTACAGGAAAGCTTAACAGG - Intergenic
1135312688 16:21418607-21418629 AAATTCCAATAAAGATTAGTCGG - Intronic
1135365605 16:21850877-21850899 AAATTCCAATAAAGATTAGTCGG - Intronic
1135446203 16:22520275-22520297 AAATTCCAATAAAGATTAGTCGG + Intronic
1136322808 16:29499122-29499144 AAATTCCAATAAAGATTAGTCGG - Intronic
1136437490 16:30239090-30239112 AAATTCCAATAAAGATTAGTCGG - Intronic
1141997918 16:87647064-87647086 GAAGGCCTGTGAAGCTTAGGTGG + Intronic
1150156343 17:62856883-62856905 GATGTACAGTAAAGCTTTGGAGG + Intergenic
1151375166 17:73683532-73683554 GAATTACAGCAAAGAGTAGGGGG - Intergenic
1153501980 18:5759174-5759196 GGCTTCCAGAAAAGTTTAGGTGG - Intergenic
1156801433 18:41119440-41119462 GAATTCCAGAAAAGACAAGGTGG - Intergenic
1157446401 18:47749538-47749560 GAATTCCAGTAACCCTTTAGAGG - Intergenic
1159586427 18:70288091-70288113 GTATTTCAGTAAAGCTTGGGGGG - Intergenic
1168602170 19:57726932-57726954 GGATTCCAGGAATGCTTTGGTGG - Intronic
927125685 2:20011186-20011208 AAAGACCAGTAAAGCTTAGGGGG + Intronic
927270388 2:21202710-21202732 GAATTCTAGTAAATATGAGGAGG - Intergenic
928106792 2:28475701-28475723 GAATTCCAGGAAAGACCAGGTGG - Intronic
930110248 2:47672793-47672815 TTATTCCTGTAAAGCTTAAGAGG + Intergenic
930335337 2:50038585-50038607 GAATCCCAGAAAAACTTAGCTGG - Intronic
931954106 2:67398231-67398253 GACTTCTAGTAAATCTTAGTTGG + Intronic
932079786 2:68702835-68702857 GACTTCAAGTAATGCTTAGAGGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
940240364 2:151556531-151556553 GAATTACAATAAAGCTTACAGGG + Intronic
940313267 2:152301729-152301751 AAATTGGAGTGAAGCTTAGGTGG + Intergenic
944591866 2:201225340-201225362 GAATTCCAGTACAAATTTGGAGG - Intronic
946519859 2:220452783-220452805 GAACTGCAGTAAAGCTTCTGAGG - Intergenic
1169663011 20:8001006-8001028 GAATTCCAGAGATACTTAGGAGG - Intronic
1170149273 20:13212098-13212120 GAATTCCTATAATGCTTAGGAGG - Intergenic
1170168327 20:13384079-13384101 AAAATCCAGTAATGCTTAAGAGG - Intergenic
1172342966 20:34173205-34173227 AGATTCCAGCAAATCTTAGGAGG - Intergenic
1174390199 20:50214312-50214334 GAATCCCATTAAAACTTAGCAGG - Intergenic
1177312537 21:19415530-19415552 AAATTTCATTAAAGCTTTGGAGG + Intergenic
1180052397 21:45337232-45337254 GAAATCCAGCACAGCTTAGCTGG - Intergenic
1180571004 22:16718686-16718708 GAATTGTAGTAAAGATTAGCTGG - Intergenic
1182873663 22:33671226-33671248 GAAATCCAGTAAAACTCAGGTGG - Intronic
955408953 3:58643531-58643553 GAATGCCCGTAGAGCTCAGGAGG - Intronic
957107197 3:75906175-75906197 GAATTGTAGTAAAGATTAGCTGG + Intergenic
960470394 3:118057591-118057613 GATTTCCACAAAACCTTAGGTGG - Intergenic
961521194 3:127468231-127468253 GTAGTCCAGGAAAGCTTAGATGG + Intergenic
962259114 3:133892045-133892067 GAATGCCATTAGAGCTTAGGAGG + Intronic
963774827 3:149428102-149428124 GAACTGCAGTAAAGTTTAGAGGG + Intergenic
965467432 3:169047868-169047890 GATTTTCAGTAAAGCATAGCTGG + Intergenic
970206341 4:13659228-13659250 GAATTACATTAAAGCCCAGGCGG - Intergenic
971717384 4:30196405-30196427 GAATCCCAGTACAGATTGGGTGG - Intergenic
977359710 4:95986554-95986576 TGATGCCAGTAAAGCTTGGGTGG + Intergenic
979229592 4:118332066-118332088 GAATACAAGTAACTCTTAGGAGG + Intronic
981452090 4:144910474-144910496 GAATTTCAGTAAAGCATAGCAGG - Intergenic
981652127 4:147072362-147072384 GAAATCCAGGAAAGCTGAGAAGG + Intergenic
981816731 4:148839646-148839668 GAATTCCAGGAAAGCAGAGGAGG + Intergenic
982644395 4:158005144-158005166 CAATTCCATTAAAACTTAAGTGG - Intergenic
984957985 4:185064813-185064835 GAATTGCTGCAAAGCATAGGTGG + Intergenic
986628413 5:9745180-9745202 GAATTCTAGGAAAGGTTAGGAGG + Intergenic
986971069 5:13337235-13337257 GAATTCCATTAAAGATTAATTGG - Intergenic
989443654 5:41503201-41503223 GAGTTCCAGGAAAGCATAGCAGG + Intronic
993848839 5:92980067-92980089 GAAGTCCAGGAAAACTTTGGTGG - Intergenic
1002179767 5:177425139-177425161 GAATTCCAGTAAAGAGATGGTGG - Intronic
1002917164 6:1538603-1538625 GCATTCCAGCAAAGCTCAGCAGG - Intergenic
1004483214 6:16040505-16040527 GAATTCCAGCATAGCACAGGTGG + Intergenic
1008368074 6:50705871-50705893 GAATTCCAGGAAAGAAGAGGCGG + Intergenic
1011497591 6:87951695-87951717 GAAACCCAGTGCAGCTTAGGAGG - Intergenic
1016876599 6:148871395-148871417 GATTTTCAGTAAATCTTAGATGG + Intronic
1020929306 7:14373064-14373086 GAATTCCAGTGAATCTCATGTGG - Intronic
1021716244 7:23465526-23465548 GACTTCCAGTGGAGCTTGGGGGG - Intronic
1028750640 7:94378673-94378695 GAATTCAAGTAGGGCTTAGCTGG - Intergenic
1029329621 7:99841290-99841312 GCATTCCAGTAAACATTAGAGGG - Intronic
1029463735 7:100711914-100711936 GACTTCCATCAAAGCTTGGGAGG + Intergenic
1031540850 7:122992915-122992937 GACTCCCAGGAATGCTTAGGAGG - Intergenic
1044423404 8:92024552-92024574 GAATTTCAGTGGAGTTTAGGAGG - Intronic
1045477545 8:102566183-102566205 GAATTCCAGTAAAGTTTGTAGGG + Intergenic
1046070881 8:109251906-109251928 GAATACAGCTAAAGCTTAGGGGG - Intronic
1051955443 9:22687538-22687560 AAGTTCCACTAAAACTTAGGGGG - Intergenic
1052244257 9:26314526-26314548 GAATTACTGTGAAGTTTAGGTGG + Intergenic
1052336977 9:27330247-27330269 GAATTCCAGTAAAGCTTAGGCGG + Exonic
1058889624 9:109350030-109350052 AAAGTCCAGTATAGGTTAGGAGG + Intergenic
1059911178 9:119045992-119046014 GAGTTCCAGGAAAGCTTAAGAGG + Intergenic
1197092363 X:122554370-122554392 GATTTACAGCAAAGCTTAGTTGG - Intergenic
1198169457 X:134091416-134091438 GAGTCACAGTACAGCTTAGGAGG - Intergenic
1200760981 Y:7038973-7038995 GAGTTGCAGAAAAGCTGAGGAGG + Intronic
1202100580 Y:21303739-21303761 GAATTCGAGTGCAGCATAGGGGG + Intergenic