ID: 1052339478

View in Genome Browser
Species Human (GRCh38)
Location 9:27351206-27351228
Sequence AGTGGGCTTTAATCCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052339473_1052339478 -8 Left 1052339473 9:27351191-27351213 CCACGCCTGGCCCACAGTGGGCT 0: 1
1: 2
2: 14
3: 121
4: 839
Right 1052339478 9:27351206-27351228 AGTGGGCTTTAATCCATGAAGGG No data
1052339467_1052339478 23 Left 1052339467 9:27351160-27351182 CCCAAAGTGTTGGGATTACAGGC 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
Right 1052339478 9:27351206-27351228 AGTGGGCTTTAATCCATGAAGGG No data
1052339468_1052339478 22 Left 1052339468 9:27351161-27351183 CCAAAGTGTTGGGATTACAGGCG 0: 9450
1: 144047
2: 280281
3: 215306
4: 144319
Right 1052339478 9:27351206-27351228 AGTGGGCTTTAATCCATGAAGGG No data
1052339465_1052339478 26 Left 1052339465 9:27351157-27351179 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 1052339478 9:27351206-27351228 AGTGGGCTTTAATCCATGAAGGG No data
1052339470_1052339478 -5 Left 1052339470 9:27351188-27351210 CCACCACGCCTGGCCCACAGTGG 0: 1
1: 8
2: 105
3: 775
4: 4149
Right 1052339478 9:27351206-27351228 AGTGGGCTTTAATCCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052339478 Original CRISPR AGTGGGCTTTAATCCATGAA GGG Intronic
No off target data available for this crispr