ID: 1052339857

View in Genome Browser
Species Human (GRCh38)
Location 9:27354236-27354258
Sequence CACCCTATCAGGCCTCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052339857_1052339862 19 Left 1052339857 9:27354236-27354258 CCACTCAGAGGCCTGATAGGGTG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1052339862 9:27354278-27354300 CAGACACCAAGAGTTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052339857 Original CRISPR CACCCTATCAGGCCTCTGAG TGG (reversed) Intronic
900906603 1:5563981-5564003 GACCCTCTCAGGCTTCTTAGTGG + Intergenic
902208483 1:14887419-14887441 CAACCCATTAGGCCTCTGATTGG + Intronic
903535889 1:24066069-24066091 CACACTTTCAGGCATCTCAGTGG + Intronic
904402727 1:30267298-30267320 CACCAGAGCAGGCCTCTAAGGGG + Intergenic
904495207 1:30882564-30882586 CACCCCATCAGGGCTGTGATGGG + Intronic
915736273 1:158087562-158087584 CACCCTAGCAGGCCCCCTAGAGG + Intronic
917647983 1:177047621-177047643 CACCGTATCAGTCCAGTGAGAGG + Intronic
921339034 1:214115953-214115975 CAGGCTATCACGCCTTTGAGTGG + Intergenic
924570067 1:245229844-245229866 CACCGAACCCGGCCTCTGAGTGG - Intronic
1064016420 10:11776064-11776086 CTACCTCTCAGGGCTCTGAGTGG - Intergenic
1067051288 10:43022844-43022866 CACTCTCTAAGGCCCCTGAGGGG - Intergenic
1067416705 10:46108101-46108123 CACAGTCTCAGGCATCTGAGTGG - Intergenic
1069624459 10:69859378-69859400 GCCCCTCCCAGGCCTCTGAGGGG + Intronic
1071265964 10:83965219-83965241 CACTGTATCAGGCATCAGAGAGG + Intergenic
1073299571 10:102462602-102462624 CACCCTACCAGGCCCCTGGTAGG - Intronic
1075403470 10:122177870-122177892 CAGCATTTCATGCCTCTGAGAGG + Intronic
1076256279 10:129027482-129027504 CACCCTCTCCATCCTCTGAGGGG - Intergenic
1076595166 10:131620582-131620604 CACCCTCCCAGGGCTCAGAGAGG - Intergenic
1076752615 10:132551166-132551188 CTACCTTTCAGGCTTCTGAGCGG + Intronic
1077047960 11:554567-554589 CACCCGAGCAGGCCTGTGAGAGG + Exonic
1079023013 11:16924589-16924611 CACCCTTTCTGCCCTCTGGGAGG + Intronic
1079869735 11:25781806-25781828 CACACTTTCAGACCACTGAGGGG + Intergenic
1083320274 11:61841782-61841804 CATCCTATAAGGCCTCAGATAGG + Intronic
1084325625 11:68398281-68398303 CACCCTAGCTGTGCTCTGAGGGG - Intronic
1087150921 11:94858962-94858984 CTCATTCTCAGGCCTCTGAGTGG + Intronic
1092234429 12:6797327-6797349 AACCCTACAAGGCCTCTGAGTGG - Intronic
1094214999 12:27931277-27931299 CACCCTAGAAATCCTCTGAGGGG + Intergenic
1098628102 12:72698031-72698053 CATCATGTCAGGACTCTGAGAGG + Intergenic
1101439840 12:104695287-104695309 CAAACTATCAGGCCTTGGAGGGG - Intronic
1101995454 12:109522273-109522295 GACCCCATCAGGCCACAGAGTGG - Intronic
1106800917 13:33255105-33255127 AACCTGATCAAGCCTCTGAGGGG - Intronic
1109524181 13:63554283-63554305 CACCCTAACAGGCTTCTCATGGG - Intergenic
1113236774 13:108284765-108284787 CACCCTGACAGGTTTCTGAGTGG - Intronic
1115486538 14:33916095-33916117 CACCCTTTCCTGCCTCTGAGTGG + Intergenic
1117627950 14:57659429-57659451 CTCCCTTTCAGGTCTCTGGGTGG - Intronic
1119427918 14:74547759-74547781 TACCCCATCAACCCTCTGAGGGG - Intronic
1121255162 14:92525570-92525592 CACCCTGGCAGGCCTCCTAGTGG - Intronic
1121415574 14:93777200-93777222 CACCCTTTCAAGCCACTGAAGGG + Intronic
1121914094 14:97820444-97820466 TTCCCTCTTAGGCCTCTGAGGGG - Intergenic
1122137554 14:99643705-99643727 CACCCTAGCAGCCCTCTGCTAGG + Intergenic
1122722986 14:103732442-103732464 CATCTCCTCAGGCCTCTGAGGGG - Intronic
1122895218 14:104753386-104753408 CCCCCGCTCAGGCCTCAGAGGGG - Intronic
1127815741 15:62607298-62607320 CATCCTTTCAAGCCTCAGAGAGG - Intronic
1130555298 15:84918396-84918418 GATCCTGTCAGGCATCTGAGTGG + Intronic
1131693686 15:94854114-94854136 CACCCCTTCAGTGCTCTGAGAGG + Intergenic
1139722733 16:68869954-68869976 CAGCCTATCAGGCCTCCCTGAGG - Intronic
1142109416 16:88323301-88323323 CACCCTCGCAGGCCGCTCAGTGG + Intergenic
1148153999 17:45412314-45412336 CACACCCTCATGCCTCTGAGAGG + Intronic
1148199549 17:45740761-45740783 CCTCCTTTCAGGCCACTGAGTGG - Intergenic
1148978032 17:51546616-51546638 CACCCTATCTGACCCCTGACTGG + Intergenic
1149383544 17:56119365-56119387 CACCCTTCTGGGCCTCTGAGTGG - Intronic
1152404369 17:80088000-80088022 CCCCCATGCAGGCCTCTGAGAGG + Exonic
1152658780 17:81532855-81532877 GACCCTATCATCCCTTTGAGGGG + Intronic
1152945110 17:83193849-83193871 CACCCCATCAGCCCTCAGGGTGG + Intergenic
1160584160 18:79903561-79903583 GACCCTGTAAGGCCTGTGAGCGG - Exonic
1163730033 19:18943637-18943659 CACCCTCTCCGGTCTCTGGGAGG + Intergenic
925158427 2:1664250-1664272 CATCCCTTCAGCCCTCTGAGGGG - Intronic
927097403 2:19757937-19757959 AACCCTATTAGGCCACAGAGAGG - Intergenic
937867707 2:126766521-126766543 CAGACTTTCAGGCTTCTGAGAGG - Intergenic
938759628 2:134412263-134412285 CACCCTCTCTCCCCTCTGAGGGG + Intronic
941196031 2:162453116-162453138 TACCCCAACAGGCCTCTGTGTGG + Intronic
944471380 2:200056356-200056378 CACACTTTCAGACCACTGAGAGG + Intergenic
944525868 2:200619111-200619133 CATCCTTTAAGGCATCTGAGCGG - Intronic
944834932 2:203569929-203569951 TACACAATCAGGCCTCTGAGTGG + Intergenic
1168774821 20:438778-438800 CACCATATCAGGCCTCTGCTGGG + Exonic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1169959253 20:11140641-11140663 CACCCTCTGAGGTGTCTGAGTGG + Intergenic
1172518059 20:35549378-35549400 CACCCCAACAGCCCTGTGAGTGG - Intronic
1173456319 20:43204884-43204906 CCCCCTTTCAGGCATCTGATAGG - Intergenic
1175332743 20:58176284-58176306 CACCCTGTGAGTCATCTGAGTGG - Intergenic
1175369903 20:58481376-58481398 CACCCTTTCTGGGTTCTGAGGGG - Intronic
1175421078 20:58834117-58834139 CACCCCATCAGACTTCTGGGAGG - Intergenic
1178678242 21:34649131-34649153 CTCCCTTTTAGGCCTCTGTGAGG - Intergenic
1182430987 22:30298836-30298858 CACCCTCTCTGGCCACTGACTGG + Intronic
1183856234 22:40636781-40636803 ACCCCGATCAGGCCTCTGATTGG - Intergenic
950096405 3:10333297-10333319 CACCCCACCAGCCTTCTGAGGGG - Intronic
952984172 3:38762845-38762867 GAACCTATCAGGCCACAGAGGGG + Intronic
955790901 3:62587853-62587875 CACCCTGCCATGCCTCTGACAGG + Intronic
956609659 3:71109800-71109822 GACCCTATCAGGCAGCTGAGGGG + Intronic
961786066 3:129347674-129347696 TCCTCTGTCAGGCCTCTGAGGGG - Intergenic
967875882 3:194268212-194268234 CAGCCTCTCAGGGCTCTGCGCGG + Intergenic
968521317 4:1035975-1035997 CACCCTCTCAGGGCCCTTAGTGG - Intergenic
969864582 4:10066082-10066104 CACCATATCTGGCTTCTAAGTGG - Intergenic
972341911 4:38159412-38159434 CTCCCTAACAGGCTTCAGAGGGG - Intergenic
976336234 4:83891075-83891097 CAACCTTTCAGGACACTGAGAGG - Intergenic
981660795 4:147164395-147164417 CACCCTTTGACTCCTCTGAGAGG - Intergenic
992080372 5:73230674-73230696 CTCCCCATCAGACCTTTGAGGGG + Intergenic
996544473 5:124663282-124663304 TACCCAAACAGGCCTCTCAGGGG + Intronic
998773952 5:145577816-145577838 CACACTAACAGGCCTCTTAAAGG + Intronic
999730205 5:154471473-154471495 TCCCCTGTCAGGGCTCTGAGTGG - Intergenic
1000698717 5:164421784-164421806 CACCCTTTCAGAGCACTGAGAGG - Intergenic
1002832026 6:830938-830960 CCCACTATCATGCTTCTGAGTGG - Intergenic
1003308536 6:4949242-4949264 CACCCCAGCAGGCCCCTGAGAGG - Intronic
1004927981 6:20434042-20434064 CACCTTATCAGGACTGTAAGAGG + Intronic
1005221657 6:23594820-23594842 CACCCTACCAGGCTTCTAATTGG + Intergenic
1005829512 6:29659345-29659367 CACCCTATCCGGGCTCTGGTCGG + Exonic
1019464819 7:1181781-1181803 CACCCCATCAGGCCTCAAACTGG + Intergenic
1022103169 7:27181034-27181056 CAAGTTATCAGGCCCCTGAGGGG - Intergenic
1023024399 7:36037607-36037629 CACCCTCCCAGGTCTCTGAGCGG + Intergenic
1024559543 7:50631716-50631738 TACCCTACCTGGCCTCCGAGGGG + Intronic
1026086422 7:67266840-67266862 CCCGCTAGCAGGCCTCAGAGAGG - Intergenic
1035385983 7:158473271-158473293 CTCCTTAGCAGGACTCTGAGTGG - Intronic
1036641224 8:10585296-10585318 CACCCTAGCAGGTCTCTGTCTGG - Intergenic
1037106201 8:15111408-15111430 CATCCACTCAGGCCTCTGATTGG + Intronic
1037803417 8:22047115-22047137 GACTCTATTAGCCCTCTGAGGGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1045474823 8:102543739-102543761 AACCCTTTCAGGGGTCTGAGAGG + Intergenic
1047816420 8:128468645-128468667 CACCACATCAGGCCGATGAGTGG + Intergenic
1048445634 8:134490787-134490809 CACCCTTTCAGAAGTCTGAGAGG + Intronic
1049372328 8:142273767-142273789 CACCCAGTCAGGCCCCTGCGTGG + Intronic
1052339857 9:27354236-27354258 CACCCTATCAGGCCTCTGAGTGG - Intronic
1053016897 9:34666983-34667005 CACCTTGTCTGCCCTCTGAGAGG + Intergenic
1057185070 9:93052952-93052974 CAGCCTTACAGGCCACTGAGAGG + Intergenic
1058635827 9:107037511-107037533 CACACTATCAGTACACTGAGGGG + Intergenic
1060992094 9:127854939-127854961 CACCCTAACAGCCCACCGAGGGG + Intergenic
1062283696 9:135763535-135763557 GACCCTATCAGGCCGCTTTGGGG + Intronic
1185839903 X:3379304-3379326 CACCCAATCAAGCCAGTGAGGGG + Intergenic
1187283542 X:17881435-17881457 CACCCTAGCAGGCATCTGTAGGG - Intergenic
1189354048 X:40298225-40298247 CACCTTCTCAGGCCCCTCAGAGG - Intergenic
1190997096 X:55620486-55620508 CTCCTTATCAGTCCTTTGAGTGG + Intergenic
1195465205 X:105172206-105172228 CAGGTTATCAGGCCCCTGAGGGG - Intronic
1196932709 X:120696862-120696884 CACACTTTCAGGGCACTGAGAGG + Intergenic
1201977701 Y:19870386-19870408 CACCATCTCAGCTCTCTGAGTGG - Intergenic