ID: 1052340403

View in Genome Browser
Species Human (GRCh38)
Location 9:27359345-27359367
Sequence CTCCCTATGACTCCTGTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052340403_1052340414 -1 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340414 9:27359367-27359389 GTGTGTGTGTGTGGGGGGGGGGG 0: 130
1: 467
2: 1777
3: 5671
4: 16340
1052340403_1052340416 4 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340416 9:27359372-27359394 TGTGTGTGGGGGGGGGGGGTTGG 0: 13
1: 56
2: 386
3: 1578
4: 6245
1052340403_1052340407 -8 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340407 9:27359360-27359382 ATAGGGAGTGTGTGTGTGTGGGG 0: 1
1: 0
2: 49
3: 355
4: 2112
1052340403_1052340406 -9 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340406 9:27359359-27359381 CATAGGGAGTGTGTGTGTGTGGG 0: 1
1: 0
2: 8
3: 106
4: 710
1052340403_1052340415 0 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340415 9:27359368-27359390 TGTGTGTGTGTGGGGGGGGGGGG 0: 111
1: 432
2: 1492
3: 4580
4: 15574
1052340403_1052340413 -2 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340413 9:27359366-27359388 AGTGTGTGTGTGTGGGGGGGGGG 0: 9
1: 209
2: 981
3: 3338
4: 13407
1052340403_1052340408 -7 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340408 9:27359361-27359383 TAGGGAGTGTGTGTGTGTGGGGG 0: 1
1: 3
2: 40
3: 610
4: 7250
1052340403_1052340412 -3 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340412 9:27359365-27359387 GAGTGTGTGTGTGTGGGGGGGGG 0: 3
1: 161
2: 996
3: 4069
4: 13771
1052340403_1052340410 -5 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340410 9:27359363-27359385 GGGAGTGTGTGTGTGTGGGGGGG 0: 4
1: 22
2: 299
3: 2786
4: 11519
1052340403_1052340411 -4 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340411 9:27359364-27359386 GGAGTGTGTGTGTGTGGGGGGGG 0: 4
1: 28
2: 381
3: 2362
4: 11914
1052340403_1052340405 -10 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340405 9:27359358-27359380 TCATAGGGAGTGTGTGTGTGTGG 0: 1
1: 0
2: 6
3: 57
4: 544
1052340403_1052340409 -6 Left 1052340403 9:27359345-27359367 CCCGTCACAGGAGTCATAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1052340409 9:27359362-27359384 AGGGAGTGTGTGTGTGTGGGGGG 0: 1
1: 7
2: 128
3: 1075
4: 9436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052340403 Original CRISPR CTCCCTATGACTCCTGTGAC GGG (reversed) Intronic
900166480 1:1246090-1246112 CGCCCCATGACTCCTGCGGCTGG - Intronic
900457762 1:2785757-2785779 CTCCCCATGTCCCCTGTGCCTGG + Intronic
901000875 1:6148238-6148260 CTTCCGATGTCTACTGTGACTGG + Intronic
901247087 1:7740135-7740157 CTCCCTATGACTGCAGTGGTTGG - Intronic
915366959 1:155322031-155322053 CCCCCTCTTCCTCCTGTGACGGG - Exonic
916171090 1:162002245-162002267 CTCCCCAGGACTCCAGTGGCTGG + Intronic
919034079 1:192283717-192283739 CTCCCTGTGACTTCTGTGTTAGG - Intergenic
921934117 1:220780190-220780212 CTGTCTATGACTCCAGTGTCTGG - Exonic
1064878310 10:20020310-20020332 CTCCTCTTGAATCCTGTGACTGG + Intronic
1065895587 10:30160688-30160710 CTCCCTGTGACTGCTTTGAAAGG + Intergenic
1067750598 10:48968829-48968851 CTCCCTGTGACTCCTGCCCCGGG + Intronic
1073295448 10:102435777-102435799 CTCTCTATGGCTCCTGGGGCTGG - Intergenic
1074525012 10:114255437-114255459 TTCCCTCTGACTACTGTGATTGG - Intronic
1075308898 10:121394704-121394726 CTCCACATGAATGCTGTGACAGG + Intergenic
1080658487 11:34276690-34276712 CTCCCCTTGTCTTCTGTGACTGG - Intronic
1081744632 11:45464284-45464306 CTCTCTCTGGCTCCTGTGGCTGG - Intergenic
1083659672 11:64246318-64246340 CGCCCTTTGACTCCAGTGACAGG + Intronic
1084709388 11:70834770-70834792 CCCTCAATGACTCCAGTGACGGG - Intronic
1088208682 11:107427268-107427290 CTTTCTATGAATTCTGTGACTGG - Intronic
1089351841 11:117825722-117825744 CGCCCCAGGACTCCTGTGCCGGG + Intronic
1089506976 11:118969987-118970009 CTACATATGACTCATGTCACGGG - Intergenic
1096805856 12:54140802-54140824 CACTCTATGATTCCTGAGACAGG + Intergenic
1104058054 12:125245494-125245516 TGCCCTCTGACTCCTGAGACAGG + Intronic
1107827913 13:44347022-44347044 CTCACAAAGACTCCTGTGAGAGG - Intergenic
1117650556 14:57900350-57900372 CACCCTCTGACTCCAGTGATTGG - Intronic
1118039759 14:61904030-61904052 CGCCCAATCACTCCTTTGACTGG + Intergenic
1118317800 14:64736541-64736563 CTCCCTATGGCTCCTGCGCGAGG + Intronic
1122336218 14:100987939-100987961 CTTCCTATCACTCCTCTAACTGG - Intergenic
1122361817 14:101172022-101172044 CAGCCTATGACTCCTGTGTTAGG + Intergenic
1126498103 15:49314931-49314953 CACCATGTGGCTCCTGTGACAGG - Intronic
1127846605 15:62876421-62876443 CTCCCTATGCCTCCTGTTCCTGG + Intergenic
1130513253 15:84606291-84606313 CTCACTAAGAATCCTGTGAGTGG + Intronic
1130563846 15:84979008-84979030 CTCCCTCCTACCCCTGTGACTGG - Intergenic
1131513671 15:93063785-93063807 CTCCCTCTTTCTCCTGTGGCTGG - Intronic
1134267852 16:12707077-12707099 CTCTCTAAGACTCCAGTGTCTGG + Intronic
1140032689 16:71351034-71351056 CTCCCTCTGGCTCCTGTGTAGGG - Intergenic
1140229679 16:73107570-73107592 CTCCACATCACTCCTGTGCCTGG + Intergenic
1141518180 16:84560198-84560220 CTCCCTGTGATGCCTGTTACGGG + Intergenic
1143176663 17:4959498-4959520 CTCCCTTTGACCCCTGGGGCAGG - Exonic
1144766944 17:17738179-17738201 CTCCCTCTGACTCCTGACAGAGG + Intronic
1146302438 17:31699997-31700019 CTTCCTATGACTGCTGGGACGGG + Intergenic
1149771407 17:59324752-59324774 CTGCCTATAATTCCAGTGACTGG + Intergenic
1150135928 17:62695121-62695143 CTCCCTAGGGCTCCTGTCTCAGG - Intergenic
1151425674 17:74029593-74029615 CTCCTCCTGACTCCTGTGAAAGG - Intergenic
1156045562 18:32873461-32873483 CTCCCTCTGACTGCTGTGGCAGG - Intergenic
1157943838 18:51956938-51956960 CTCCCTGTAACTCCTGTCACAGG - Intergenic
1160847456 19:1172886-1172908 CTGCCTGTGACTGCTGGGACGGG - Intronic
1163265539 19:16218457-16218479 CTCCCAGTGACTCCTGTGGAGGG - Intronic
1167209293 19:48123003-48123025 CTCCCTCAGACTCCTGCGAGGGG - Exonic
925614134 2:5729304-5729326 CTCCCTATGGTTCCTGGGCCTGG + Intergenic
928468901 2:31553861-31553883 CTCCCTGTGGCTGCTGTAACAGG + Intronic
929018745 2:37528783-37528805 CTCCATGTGTCTCCTGTCACAGG + Intergenic
929175110 2:38968117-38968139 CTCCCTCTGCCTCATGTCACTGG - Intronic
932781068 2:74558807-74558829 CTGCCTATGACTCCTGTCCCAGG - Exonic
934219166 2:90065537-90065559 CTCCCAGTGACTCCTGTGATAGG - Intergenic
939780512 2:146440946-146440968 CACCCTAGTAGTCCTGTGACAGG + Intergenic
941246154 2:163099574-163099596 CTGACTCTGACTCCAGTGACTGG - Intergenic
944408327 2:199411167-199411189 CTTCCTTTGCCACCTGTGACGGG + Intronic
946681137 2:222217473-222217495 CTCCCTATCAATCCTTTGGCTGG + Intronic
1171988433 20:31676922-31676944 CTCCCTCTGTCTCCCTTGACTGG + Intronic
1172057486 20:32164670-32164692 CTGCCTGTGAGTCCTGGGACAGG + Intronic
1174142804 20:48428301-48428323 TTCCCTATGACTGCTTTGACAGG + Intergenic
1174548576 20:51344738-51344760 ATCCCTATAACTCCTGTGCAGGG + Intergenic
1180030328 21:45202283-45202305 CTGCTGATGACTGCTGTGACAGG + Intronic
1180138495 21:45876557-45876579 CTCCGAATGCCGCCTGTGACAGG + Intronic
1182111040 22:27723897-27723919 CACTCTCTGACTGCTGTGACTGG - Intergenic
1182835822 22:33340604-33340626 CTCCATGGGACACCTGTGACGGG + Intronic
1184942890 22:47781976-47781998 CTCCCAATTGCTCCAGTGACAGG - Intergenic
952898975 3:38097257-38097279 GTACCTATGACCCCTGTGCCGGG - Exonic
953886996 3:46719745-46719767 CTCCCTGTGGCTCCTGTGAGCGG - Exonic
954088711 3:48267875-48267897 CTTCCTATGACTCTTCTGACTGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
959867327 3:111285827-111285849 CTGCCTATGATTCCTATGACTGG + Intergenic
960518800 3:118631623-118631645 CACGCTATGACTTCTGAGACTGG + Intergenic
961710265 3:128823166-128823188 CTCCCTCTGTCTCCTGTGCTGGG - Intergenic
963122697 3:141789537-141789559 CTTCCTCTGGCTCCTGGGACAGG - Intronic
966496981 3:180592308-180592330 CCCCCTGTGACTTCTGTGGCTGG + Intergenic
981660795 4:147164395-147164417 CACCCTTTGACTCCTCTGAGAGG - Intergenic
985838344 5:2287539-2287561 CTCCCTCAGTCTCCTGTGAGCGG - Intergenic
990115760 5:52388574-52388596 CTCACTATGACTGCTGTGTAAGG + Intergenic
990983151 5:61619579-61619601 CTCCCCTTGACTCCTGGGCCTGG - Intergenic
1000492078 5:161926267-161926289 CTCCCTCTGGCTCCTTTCACAGG - Intergenic
1002086616 5:176779944-176779966 CTCCGTGTGGCACCTGTGACAGG + Intergenic
1014627876 6:123751893-123751915 CTCACTATGAATCATCTGACTGG - Intergenic
1018934936 6:168267800-168267822 CTCCCTCTGTCCCCTCTGACAGG + Intergenic
1019681042 7:2349843-2349865 CTGCCTCAGCCTCCTGTGACAGG + Intronic
1021357645 7:19672075-19672097 CTGACTATGACTGCTGTGAAAGG - Intergenic
1021414346 7:20365082-20365104 CTCCCTGTCACACCTTTGACTGG + Intronic
1031547596 7:123068911-123068933 CTCCCAGTGACTCCTGGGAAAGG - Intergenic
1031982570 7:128137070-128137092 CTCACAATGATTCCTGTGGCAGG - Intergenic
1034272559 7:149810396-149810418 GTCTCACTGACTCCTGTGACTGG - Intergenic
1034872472 7:154696340-154696362 CTCACTGCGACTCCTGTCACTGG - Intronic
1036574326 8:10011625-10011647 TCCCCTATGACTCCTGTGTGGGG + Intergenic
1040580529 8:48695235-48695257 CTCCTTATGACTAGTGTGGCAGG - Intergenic
1042796225 8:72665973-72665995 CTCCCCATGTCCCCTGGGACAGG + Intronic
1051893479 9:21966010-21966032 CTCCATATATCTCCTGTGCCTGG - Intronic
1052340403 9:27359345-27359367 CTCCCTATGACTCCTGTGACGGG - Intronic
1053183763 9:35996876-35996898 AGCCCTATGACTCCAGAGACAGG - Intergenic
1053192307 9:36082522-36082544 CTCCCTTAGATTCCTGTGAGGGG + Intronic
1060146181 9:121254446-121254468 CTCCCTCAGACTCCTGTCTCCGG + Intronic
1062413189 9:136434851-136434873 CTCCAGGTAACTCCTGTGACGGG + Exonic
1188262324 X:28035782-28035804 GTCCCTAAGACCCCTGTGAATGG + Intergenic
1190533265 X:51402131-51402153 CTCACTACCACTCCAGTGACTGG - Intergenic
1191597232 X:62959280-62959302 CTCCCAATGACTCCAGGGAATGG + Intergenic
1192996893 X:76521256-76521278 CTCCCAATGACTCCTGTGCAAGG - Intergenic
1195744951 X:108107831-108107853 CTCCCTAGGCCTCCATTGACAGG + Intronic
1202088339 Y:21162652-21162674 CTCTCTTTGACTCCTGTGTTAGG + Intergenic