ID: 1052347273

View in Genome Browser
Species Human (GRCh38)
Location 9:27422432-27422454
Sequence CTATATCAACAGAATTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052347273_1052347279 25 Left 1052347273 9:27422432-27422454 CCTCTCTAATTCTGTTGATATAG 0: 1
1: 1
2: 1
3: 11
4: 172
Right 1052347279 9:27422480-27422502 ATGGAAGTTAAAGTTATTAATGG No data
1052347273_1052347276 6 Left 1052347273 9:27422432-27422454 CCTCTCTAATTCTGTTGATATAG 0: 1
1: 1
2: 1
3: 11
4: 172
Right 1052347276 9:27422461-27422483 CTAGGTTTCTAGACACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052347273 Original CRISPR CTATATCAACAGAATTAGAG AGG (reversed) Intronic
901724628 1:11231169-11231191 CTACATGAACAAAATTGGAGAGG + Intronic
903818137 1:26080338-26080360 TTATATAAACAGAATTATACAGG - Intergenic
908003684 1:59707007-59707029 CTATATCCCCAGAGTTGGAGAGG - Intronic
908282551 1:62556828-62556850 CTATATATACTGAACTAGAGGGG + Intronic
909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG + Intergenic
909861812 1:80615748-80615770 CTATATCAACAGTAATATTGGGG + Intergenic
909981599 1:82108789-82108811 CTAATTCAACAGAATTATACTGG + Intergenic
910374958 1:86558505-86558527 CTTTATTAACAGCATAAGAGTGG - Intronic
912465600 1:109871289-109871311 CTTTACCAAAAGAATTTGAGAGG + Intergenic
912847325 1:113086573-113086595 CTACAGCAACAGAAATGGAGGGG - Intronic
918788969 1:188801090-188801112 CTATATTAAAAAAATTAAAGGGG + Intergenic
919596708 1:199573058-199573080 AAATATCGACAGAAATAGAGAGG + Intergenic
920903349 1:210134720-210134742 CTTTATCAACAGTTTTACAGTGG - Intronic
921695248 1:218201919-218201941 CTAATTCAACAGAATTAGAGGGG - Intergenic
922736889 1:227990241-227990263 CCATATCAACAGAATGAAGGGGG + Intergenic
923428191 1:233892596-233892618 CTTTATCAACAGCATGAAAGGGG + Intergenic
924334315 1:242971887-242971909 GTAGAAGAACAGAATTAGAGAGG - Intergenic
1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG + Intergenic
1063537249 10:6895898-6895920 CCATATTAACAGAATCAGGGTGG + Intergenic
1063649818 10:7923196-7923218 GTATGTGAACAGAAATAGAGCGG + Intronic
1065521217 10:26575254-26575276 CTATATTTACAGAAATACAGGGG + Intergenic
1066152101 10:32633653-32633675 CTAAATCAATAGAATTAGAAAGG - Intronic
1074172496 10:110956467-110956489 CTATATCCAAAGAAGCAGAGTGG - Intronic
1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG + Intergenic
1079556627 11:21766531-21766553 GTTTATCAACAGATTAAGAGAGG - Intergenic
1082178785 11:49093437-49093459 CAAAATCAACAGAAATAGAGGGG - Intergenic
1082734106 11:56837595-56837617 CAACATCAACAGCATTAGTGAGG - Intergenic
1083548417 11:63566099-63566121 CTATCTCAACACAAGTAGTGAGG - Intergenic
1086686488 11:89739395-89739417 CAAAATCAACAGAAATACAGGGG + Intergenic
1087922749 11:103885611-103885633 CTATACCAACAAAATTATAAAGG + Intergenic
1088082106 11:105931021-105931043 CTGTATCAAGTGAATCAGAGAGG + Intronic
1090893343 11:130947445-130947467 CTATGTCAAGAGAATGAGAAGGG - Intergenic
1091495593 12:969999-970021 TTATATCACCAGAAATGGAGTGG - Intronic
1093573601 12:20698659-20698681 CTATATCCACATAATAGGAGTGG - Intronic
1094469630 12:30791690-30791712 ATATAAAAACAGAATTAGAGAGG - Intergenic
1100416664 12:94385112-94385134 GGGTATCAACAGAAGTAGAGTGG - Intronic
1107007068 13:35624519-35624541 ATATATCAAAAGAATTTGATTGG - Intronic
1109548755 13:63864128-63864150 CTATTTCAAAAGAATTGAAGAGG + Intergenic
1109812556 13:67533426-67533448 ATATATCAACAAAATGAGTGGGG + Intergenic
1111705259 13:91740561-91740583 CTATATAAACAGAAATGGATTGG - Intronic
1113718176 13:112529349-112529371 TTATATCAACAGATTAAAAGAGG + Intronic
1114419433 14:22568856-22568878 AAAAATCAAAAGAATTAGAGGGG - Intronic
1115300891 14:31883712-31883734 CTATAACAAGACAATTTGAGTGG - Intergenic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1115771614 14:36667687-36667709 CTATTTCAACAAAATAAGAGAGG - Intronic
1116045934 14:39742227-39742249 CTTTATCAGCAGCATTAGAATGG + Intergenic
1116091277 14:40309930-40309952 CTATATAACAAGAATTAAAGAGG + Intergenic
1117118588 14:52543750-52543772 CTATATCATAAAAATTTGAGGGG + Intronic
1118556093 14:67024423-67024445 CTTTATCAAGAGAAGTACAGGGG + Intronic
1120206482 14:81592087-81592109 TTATATCTACAGAGGTAGAGAGG - Intergenic
1122032610 14:98924443-98924465 CTCTATCAACTGCAATAGAGAGG - Intergenic
1122222084 14:100246071-100246093 AAATATCAACAGCCTTAGAGAGG - Intronic
1122759165 14:104008445-104008467 TCAAATCAAGAGAATTAGAGAGG + Exonic
1122922836 14:104887023-104887045 CGGCATCCACAGAATTAGAGAGG - Exonic
1126028090 15:44467873-44467895 CTACATTAAAAGAATAAGAGGGG - Intronic
1134210529 16:12272576-12272598 CTATGTAATCAGAATTTGAGGGG - Intronic
1138178138 16:54921924-54921946 CTATATTAACAGAATTAGAGGGG - Intergenic
1138823559 16:60290557-60290579 CTATATCTACTGGATAAGAGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1147477353 17:40724789-40724811 CTTTATCAGCAGGATGAGAGTGG + Intergenic
1147508563 17:41045629-41045651 CCATATCACCACAATTAGAATGG + Intergenic
1149249476 17:54751862-54751884 CAAAATCAACAGAATTTCAGGGG - Intergenic
1149420198 17:56503094-56503116 CTATATCCACAGAAAAGGAGCGG - Intronic
1155974216 18:32110569-32110591 CTATACTAACAGAAGTTGAGAGG - Intronic
1157218810 18:45809288-45809310 CTACACTAACAGGATTAGAGAGG + Intergenic
1157232438 18:45930839-45930861 TCATATCAAGAAAATTAGAGTGG + Intronic
1158226076 18:55202976-55202998 CTACATCAACCCAATTAGATAGG - Intergenic
1159422421 18:68239797-68239819 TTATATCAACAGAATAAAAAAGG + Intergenic
1160293351 18:77615949-77615971 CCCTATTAATAGAATTAGAGGGG + Intergenic
1164384369 19:27760640-27760662 CTCTATCATCAGAATTACTGGGG + Intergenic
1166895561 19:46019906-46019928 TTATATAGACAGAATCAGAGCGG + Intronic
1167890766 19:52537358-52537380 AGATATGTACAGAATTAGAGAGG + Intronic
927282164 2:21318345-21318367 CTACATCAGCAGAGTTGGAGGGG - Intergenic
928468619 2:31549624-31549646 CAAAATTACCAGAATTAGAGAGG + Intronic
934603797 2:95679240-95679262 TTATATCAACAGAGAGAGAGAGG + Intergenic
937119052 2:119429575-119429597 CTATCTCACCAGGATTTGAGAGG + Intergenic
937575868 2:123421413-123421435 CTATAGCAACAGGAATACAGAGG + Intergenic
937804557 2:126123779-126123801 CTATAACTATAGAAGTAGAGGGG - Intergenic
939001108 2:136735842-136735864 CTTTATCAACAAAGTTAGATTGG + Intergenic
940916870 2:159265771-159265793 CTAGATCAAGAGAAGTAGGGTGG + Intronic
941308853 2:163905069-163905091 CAATATCAACAGGATTAAAGGGG - Intergenic
941538194 2:166747580-166747602 GTATATAAACAGAAATGGAGTGG + Intergenic
942712742 2:178855698-178855720 CTAAATCAATAGAATTTGGGGGG - Intronic
942950259 2:181713311-181713333 CTTTATCAACAGAATGAAAATGG + Intergenic
944347186 2:198683661-198683683 CTATAACAGCAGAATTATATAGG + Intergenic
946557849 2:220879270-220879292 CTATATAAACAGAATTACTATGG - Intergenic
1169744437 20:8929032-8929054 CTATATAAAAAGAATTAGCAGGG - Intronic
1170029347 20:11928940-11928962 CTGTATCAACACAATTATAAGGG - Intergenic
1170094141 20:12627473-12627495 TTAAATTAACAGATTTAGAGTGG - Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1171075906 20:22123079-22123101 CTATTACAACAAAATTAGACAGG - Intergenic
1181137195 22:20776529-20776551 CTATTTCAACAGTATTATAAGGG + Intronic
1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG + Intronic
951309258 3:21104252-21104274 TTAAATCAACAAAATTAGAAAGG - Intergenic
951421781 3:22494868-22494890 TTATATCAGCAGAATGAGACTGG - Intergenic
956641917 3:71423618-71423640 CCATAGAACCAGAATTAGAGAGG + Intronic
957251107 3:77772133-77772155 CTTTATCAACAGAATGAAAATGG - Intergenic
957278428 3:78118660-78118682 CTGTATCAACAAATTTAGTGTGG + Intergenic
959219313 3:103496055-103496077 CTATATCAACATAATTTCACTGG - Intergenic
961078793 3:124006603-124006625 CTATATTAAATGTATTAGAGTGG - Intergenic
965056236 3:163720799-163720821 CTATTTCAACAGAAGTGTAGTGG - Intergenic
965098838 3:164271469-164271491 CTATGGCAAGAGAATCAGAGAGG - Intergenic
965351764 3:167621008-167621030 ATATAACAAAAGGATTAGAGAGG - Intronic
965830842 3:172787355-172787377 CTGTCTCAAGAGAATGAGAGAGG - Intronic
966521587 3:180879825-180879847 CAAGATCAACAGAATAAAAGTGG - Intronic
969049281 4:4361159-4361181 CTATAACTACAGTATTAGATGGG + Intronic
970677528 4:18468745-18468767 TTATATAAAGAAAATTAGAGAGG + Intergenic
971946759 4:33288259-33288281 CTACATGAAAGGAATTAGAGTGG + Intergenic
972141730 4:35969049-35969071 CTATCTCAACAGAGTAATAGAGG + Intronic
973035068 4:45396325-45396347 CTTTATCAGCAGAATTAAAATGG - Intergenic
974010023 4:56598163-56598185 CTCACTCAAAAGAATTAGAGTGG - Intronic
974742093 4:66020809-66020831 CTTTATTAGCAGCATTAGAGTGG - Intergenic
975162690 4:71141996-71142018 TTATATCCAAAGCATTAGAGTGG + Intergenic
975465583 4:74705444-74705466 CTTTATCCACAGGAGTAGAGTGG + Intergenic
976141529 4:81998146-81998168 TTATTTCTACAGATTTAGAGAGG - Intronic
976431591 4:84967526-84967548 CTTAAACAACAGAGTTAGAGTGG + Intergenic
976730014 4:88252313-88252335 CTTTATCAACAGCATGAGAATGG - Intergenic
976786790 4:88830608-88830630 ATACATCATCAGAATTAAAGAGG - Intronic
977289530 4:95149034-95149056 CTGCATCAACAGAAATAAAGGGG - Intronic
979167403 4:117553223-117553245 CTAAAGCAATAGAATTAGAAGGG + Intergenic
979242794 4:118463399-118463421 GTAGAAGAACAGAATTAGAGAGG + Intergenic
979955370 4:126947652-126947674 CTAGATCAGCAGAAGTATAGAGG - Intergenic
980068130 4:128213770-128213792 CTATATAAAAGGAATTAGTGGGG + Intronic
982881618 4:160725832-160725854 CTATATCAATAAATTTAGAGCGG - Intergenic
984251944 4:177346156-177346178 ATAATTCAACTGAATTAGAGAGG - Intronic
986925959 5:12751110-12751132 CTATATCAACAGACTAAAAAAGG - Intergenic
987225252 5:15833146-15833168 CTTTATCAGCAGAATGAAAGCGG + Intronic
988154262 5:27430085-27430107 AAATATCAACTGAATTAGACTGG - Intergenic
989553972 5:42769644-42769666 GAATATCAACAGAATTTGAAAGG + Exonic
990671220 5:58132232-58132254 CAAGATCAACGGAATTAGAATGG + Intergenic
991077603 5:62558432-62558454 CTATTTCAACAAAAATATAGTGG + Intronic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
992812491 5:80403145-80403167 CTATATCAACAGTAAAAAAGAGG - Intergenic
993874996 5:93296029-93296051 GTTTAGCAGCAGAATTAGAGAGG + Intergenic
994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG + Intergenic
994674747 5:102806181-102806203 CTGTCTAAACAGAATTAGGGTGG - Intronic
996442435 5:123507328-123507350 CTAAAGAAACATAATTAGAGAGG + Intergenic
996800168 5:127394638-127394660 CTAGATTAAAAGAATTACAGTGG + Intronic
1000223935 5:159239785-159239807 GTATATCAACATATTTACAGTGG - Intergenic
1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG + Intergenic
1003705865 6:8528259-8528281 CTATATGCACAGAAAGAGAGTGG + Intergenic
1004539810 6:16539050-16539072 CTAAATGAACAGACTTAGAGTGG - Intronic
1005151706 6:22759073-22759095 CTCTTTCCATAGAATTAGAGGGG - Intergenic
1007035181 6:38666723-38666745 CCAGATCCACAGAATCAGAGTGG + Intergenic
1010397227 6:75406327-75406349 CAACATGAACAGAATCAGAGTGG - Intronic
1010957784 6:82110194-82110216 CTATATGAAAAAAATTAAAGAGG + Intergenic
1011432056 6:87297982-87298004 CTCTGTCACCAGAATTAAAGAGG + Intronic
1014010994 6:116475459-116475481 CTATATCTCAAGAGTTAGAGAGG + Intergenic
1014433448 6:121396255-121396277 TAATATGAACAAAATTAGAGAGG - Intergenic
1014621534 6:123673907-123673929 CTATATCAACAGCATGAAAATGG - Intergenic
1018485936 6:164241220-164241242 CTTTATCAGCAGAATGAAAGTGG - Intergenic
1018646121 6:165950414-165950436 TTCTATCAAAAGAATGAGAGAGG + Intronic
1019919216 7:4152245-4152267 CTACAGCAACAGAACTCGAGGGG + Intronic
1020789325 7:12606204-12606226 TTATATCAACAGATTTTGACAGG - Intronic
1022351868 7:29573721-29573743 ATATATAAACAGAACTTGAGTGG + Intergenic
1029320372 7:99753377-99753399 CTATTTCTACAGACTTAGAGGGG - Intergenic
1030772001 7:113486671-113486693 CTATTTCAGCAGATGTAGAGAGG + Intergenic
1032325037 7:130919799-130919821 GTATATCAAAAGATTAAGAGAGG + Intergenic
1032697172 7:134347521-134347543 CTAACTCAACATAATTAAAGTGG + Intergenic
1038654126 8:29433082-29433104 ATATTTCAACAGAATGGGAGTGG - Intergenic
1039668845 8:39572087-39572109 AAGTATCAAGAGAATTAGAGAGG - Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040719448 8:50299671-50299693 CAATATGAACATTATTAGAGAGG + Intronic
1044272508 8:90264086-90264108 CTATTTAAACACAATTTGAGCGG + Intergenic
1044285742 8:90410774-90410796 CTAAATCAACAGGATAAGAAGGG - Intergenic
1044949800 8:97424651-97424673 CTATATCCACAGAATTTGTGAGG + Intergenic
1045831435 8:106465776-106465798 TTATATCACTAGATTTAGAGTGG + Intronic
1048139487 8:131779553-131779575 TAATAGCAACAGAAGTAGAGAGG - Intergenic
1050619529 9:7438234-7438256 CTACATAGACAGAATTAGATTGG + Intergenic
1052347273 9:27422432-27422454 CTATATCAACAGAATTAGAGAGG - Intronic
1052442646 9:28517465-28517487 CTAAATTAAAAGAATTGGAGGGG + Intronic
1057885254 9:98824776-98824798 CTATCTCAAGAGAATTATAGTGG + Intronic
1058164815 9:101607387-101607409 CTATAGCAACAGACTTACACAGG + Intronic
1060331927 9:122680328-122680350 CTATATGTACAGCATGAGAGTGG - Intergenic
1189801992 X:44699990-44700012 CTAAATACACAGAATTAGTGGGG - Intergenic
1189983588 X:46533917-46533939 CTTTATCAACAGCATGAGAACGG - Intronic
1190940468 X:55035458-55035480 CAATATCAACAAAATCAGGGAGG + Intergenic
1191842725 X:65524654-65524676 CTAGAACAGCAGAATTGGAGGGG - Intronic
1192577451 X:72254378-72254400 ATATATAAATAGGATTAGAGTGG - Intronic
1194140621 X:90204513-90204535 CTAAATCAACAGGCTTACAGGGG - Intergenic
1199208765 X:145181295-145181317 TTATATCACCTGAATTGGAGGGG - Intergenic
1199621958 X:149709708-149709730 CTATATTAACAAGATTATAGAGG + Intronic
1200486387 Y:3773639-3773661 CTAAATCAACAGGCTTACAGGGG - Intergenic
1201668742 Y:16491101-16491123 CTATATCACCAGCATTAGGATGG + Intergenic
1202390527 Y:24365500-24365522 GTAGAAGAACAGAATTAGAGAGG + Intergenic
1202480257 Y:25304616-25304638 GTAGAAGAACAGAATTAGAGAGG - Intergenic