ID: 1052348763

View in Genome Browser
Species Human (GRCh38)
Location 9:27436932-27436954
Sequence CGCGTTCTGTTCCTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052348763_1052348769 -4 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348769 9:27436951-27436973 CGCGCAAAGGCTCGGGGAAAGGG No data
1052348763_1052348778 22 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348778 9:27436977-27436999 AGGGGGAAGAGCTGGGAGTGGGG No data
1052348763_1052348771 3 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348771 9:27436958-27436980 AGGCTCGGGGAAAGGGAGTAGGG No data
1052348763_1052348779 23 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348779 9:27436978-27437000 GGGGGAAGAGCTGGGAGTGGGGG No data
1052348763_1052348767 -10 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348767 9:27436945-27436967 ACAGAACGCGCAAAGGCTCGGGG No data
1052348763_1052348768 -5 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348768 9:27436950-27436972 ACGCGCAAAGGCTCGGGGAAAGG No data
1052348763_1052348772 4 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348772 9:27436959-27436981 GGCTCGGGGAAAGGGAGTAGGGG No data
1052348763_1052348774 14 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348774 9:27436969-27436991 AAGGGAGTAGGGGGAAGAGCTGG No data
1052348763_1052348770 2 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348770 9:27436957-27436979 AAGGCTCGGGGAAAGGGAGTAGG No data
1052348763_1052348780 24 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348780 9:27436979-27437001 GGGGAAGAGCTGGGAGTGGGGGG No data
1052348763_1052348775 15 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348775 9:27436970-27436992 AGGGAGTAGGGGGAAGAGCTGGG No data
1052348763_1052348776 20 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348776 9:27436975-27436997 GTAGGGGGAAGAGCTGGGAGTGG No data
1052348763_1052348777 21 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348777 9:27436976-27436998 TAGGGGGAAGAGCTGGGAGTGGG No data
1052348763_1052348773 5 Left 1052348763 9:27436932-27436954 CCAGACACAAGGAACAGAACGCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1052348773 9:27436960-27436982 GCTCGGGGAAAGGGAGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052348763 Original CRISPR CGCGTTCTGTTCCTTGTGTC TGG (reversed) Intronic
900612003 1:3548217-3548239 CGCGCTGTGTTCCGTCTGTCTGG - Intronic
902527503 1:17068779-17068801 TGTGTTCTGTTCCTTATGTCAGG + Exonic
903390828 1:22962670-22962692 CACGTGCTGTTCCATCTGTCTGG + Intronic
906748495 1:48238256-48238278 CACACACTGTTCCTTGTGTCTGG - Intronic
907301077 1:53486676-53486698 TCCGTGCTGTTCCTTCTGTCCGG - Intergenic
907364933 1:53950242-53950264 CTCGTTCTGTTCCCTTTGGCTGG - Intronic
908959333 1:69676238-69676260 AGGATTATGTTCCTTGTGTCTGG - Intronic
911115630 1:94243968-94243990 CATTTTCTGTTTCTTGTGTCAGG - Intronic
917277984 1:173351228-173351250 CCCATTCTGTTCCCTCTGTCTGG + Intergenic
1068958707 10:62844961-62844983 CTCCTTCTTGTCCTTGTGTCTGG + Intronic
1073089676 10:100924557-100924579 TGCTTTGTGTTCCTTGTGTTTGG - Exonic
1076802852 10:132839457-132839479 CGGGTGCTGTTCCGTGTGTGTGG - Intronic
1080491999 11:32775289-32775311 GGCTTGCTGTTCCTTCTGTCTGG + Intronic
1081087165 11:38815349-38815371 TGCGTTAAGTTCATTGTGTCAGG - Intergenic
1083620498 11:64047079-64047101 GACGTGCTGTTCCCTGTGTCTGG + Intronic
1086984642 11:93234512-93234534 CACATTCTTTTCCTTGTGTGTGG - Intergenic
1087875011 11:103344519-103344541 TACCTTCTGTTCCTTTTGTCTGG + Intronic
1088402392 11:109435648-109435670 CAGGTTCTGTTCCTTCTGACTGG + Intergenic
1096330485 12:50707976-50707998 CGCTTTCCGTTCCTTCTGCCCGG + Intronic
1098110420 12:67115657-67115679 CTCATGCTGTTCCCTGTGTCAGG - Intergenic
1098610536 12:72452110-72452132 CGATTTCTGTTTCTTTTGTCAGG + Intronic
1100733744 12:97503016-97503038 CATGTCATGTTCCTTGTGTCTGG + Intergenic
1102756346 12:115344154-115344176 CGAGATCTGTACCTTGTGTTAGG + Intergenic
1102971998 12:117176128-117176150 CGTGTTGTGGTCCTTGTGTTAGG - Intronic
1104783028 12:131433404-131433426 CGCGTCCTCTCCCCTGTGTCCGG + Intergenic
1104783207 12:131433909-131433931 CGCGTCCTCTCCCCTGTGTCCGG + Intergenic
1107087974 13:36446630-36446652 GGCTTTATGTTCCGTGTGTCTGG + Intergenic
1107730260 13:43341439-43341461 TACGTTCTGTTCCTTCTGCCTGG - Intronic
1108700945 13:52943694-52943716 CCTGTTCTGTTCCTTCTGTCTGG - Intergenic
1111898168 13:94167657-94167679 CACGTGCTGTTCCTTCTGCCTGG - Intronic
1116017661 14:39426702-39426724 CGCTTACTGTTTCTTGTGTGTGG + Intronic
1119513007 14:75226586-75226608 TGCATGCTGTTCCTTCTGTCTGG - Intergenic
1126457254 15:48877202-48877224 CGAGGTGTGTTCCTTATGTCCGG - Intronic
1138526844 16:57613641-57613663 CACATGCTGTTCCTTCTGTCTGG + Intronic
1138570696 16:57870227-57870249 AGCCTTCTGGTCCTTGTGTTTGG - Intergenic
1138681861 16:58689656-58689678 CTTGTTTTGTTCCTTGTTTCAGG + Intergenic
1141337827 16:83173914-83173936 CCTGTTCTGTTCCCTGGGTCTGG - Intronic
1141641726 16:85345464-85345486 CGCTTGCTGTTCCTTGTTCCAGG + Intergenic
1145016464 17:19401821-19401843 CACGTGCTGTCCCCTGTGTCTGG + Intergenic
1150410155 17:64935599-64935621 TGCGTGCTATTCCTTCTGTCTGG + Intergenic
1155240207 18:23857378-23857400 CCCGCTCTGTTCCTTCTGTCTGG + Intronic
1157805280 18:50653261-50653283 CACTTGCTGTTCCTTTTGTCAGG - Intronic
1158438226 18:57449729-57449751 CACGTTCTGTTCCTTCTGCCTGG + Intronic
1158543794 18:58379034-58379056 GGCATTGTGTTCCTTGTGTGGGG + Intronic
1158613759 18:58967445-58967467 TGCTTTCTGTTCCTTTTGCCTGG + Intronic
1166563699 19:43750307-43750329 CGCTTGCTGTTCTTTCTGTCTGG + Intronic
1166647058 19:44540025-44540047 GGCATTCTGTGACTTGTGTCCGG - Intergenic
925349035 2:3188455-3188477 CGGGGTCTGTTCTCTGTGTCTGG - Intergenic
931067734 2:58605491-58605513 CGTGTTCTGTTCCCTGTCCCTGG + Intergenic
931717450 2:65040377-65040399 CTTGTTCTGTTCCCTGTTTCTGG - Intergenic
939126829 2:138187570-138187592 CAAGTTCTGTTCCTTCTGCCTGG + Intergenic
946601332 2:221363232-221363254 GGCTTTCTGGTTCTTGTGTCTGG + Intergenic
948802050 2:240437396-240437418 CGGGTTCTGTTCCTTCTGTGGGG - Intronic
1170303065 20:14907626-14907648 CGCTTTCTATTCCTTATGCCTGG - Intronic
1173504647 20:43577188-43577210 CACATGCTGTGCCTTGTGTCTGG - Intronic
1181785354 22:25222615-25222637 CGCCTGCTGTTCCTTTTGTCTGG - Intronic
1184513390 22:44945926-44945948 CCCGTGCTGTTCCTTCTGCCTGG + Intronic
952962760 3:38603078-38603100 CATTTGCTGTTCCTTGTGTCTGG + Intronic
953484566 3:43283145-43283167 CCTATTCTGTTCCTTCTGTCTGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
957212723 3:77280993-77281015 CATATTCTGTTCCTTGTGCCTGG - Intronic
959041187 3:101424549-101424571 GGTGTGCTGTTCTTTGTGTCTGG - Intronic
962441078 3:135416617-135416639 CAGGTTCTGTACCATGTGTCAGG + Intergenic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
972774454 4:42228431-42228453 CGCTTGCTTTTCCTTCTGTCTGG + Intergenic
982564373 4:156970784-156970806 ACCGTTCTGTTCCTTGTTGCTGG + Exonic
985044423 4:185925997-185926019 TGTGTGCTGTTCCCTGTGTCTGG - Intronic
988468356 5:31512867-31512889 AGAGTTCAGTTGCTTGTGTCTGG - Intronic
988998642 5:36738600-36738622 CTCATTCTGTTCCTTCTGCCTGG + Intergenic
989039158 5:37209060-37209082 CGCCTTCTGTCCCTAGTCTCCGG + Intronic
1011400257 6:86953681-86953703 TGTTTTCTGTTCCTTGAGTCTGG - Intronic
1011555173 6:88566071-88566093 CACGTGAGGTTCCTTGTGTCCGG + Intergenic
1017163974 6:151390973-151390995 CGCGTTCGGTTCCCCGTGGCCGG - Intronic
1018912952 6:168114496-168114518 CGACTTCTGTTCATTGTGGCAGG + Intergenic
1020763073 7:12291219-12291241 CGCTTTCTGTCCCTTGTTTGAGG + Intergenic
1025606288 7:63042094-63042116 CGCATCCTGTCCCTTCTGTCCGG - Intergenic
1028840050 7:95419377-95419399 CTCATGCTGTTCCTTGTGCCTGG - Intronic
1030200001 7:106892851-106892873 CTCGTGCTGTTCTTTCTGTCTGG - Intronic
1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG + Intergenic
1035651462 8:1269017-1269039 GGAATTCTGTTCCTTGTCTCTGG - Intergenic
1037996983 8:23359874-23359896 CCCATGCTGTTCCTTGTGCCTGG + Intronic
1043063918 8:75542475-75542497 CACCTGCTGTTCCTTCTGTCTGG - Intronic
1048144576 8:131828529-131828551 TGCATGCTGTTCCTTATGTCTGG + Intergenic
1049912065 9:278691-278713 CACGTACTGTTCCTTCTGACTGG - Intronic
1052348763 9:27436932-27436954 CGCGTTCTGTTCCTTGTGTCTGG - Intronic
1062732794 9:138119083-138119105 CACGTTCTGTTCCTCCTTTCCGG + Intronic
1192434036 X:71131656-71131678 CACGTTCAGCTCCATGTGTCAGG + Intronic
1195397888 X:104430638-104430660 CACGTGCTGTTCCTTCTGTCTGG + Intergenic