ID: 1052351998

View in Genome Browser
Species Human (GRCh38)
Location 9:27467563-27467585
Sequence CCTCATCCAAACCACGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052351998 Original CRISPR CCTCATCCAAACCACGAGTG GGG (reversed) Intronic
904526591 1:31138262-31138284 CCTGATCCAGACCGCAAGTGAGG + Intergenic
909720922 1:78768120-78768142 CCTCCTCAAAACCACCACTGGGG + Intergenic
914810763 1:151026127-151026149 CCTCATCCTAACCAAGAGCCAGG - Intronic
915314205 1:155018747-155018769 CCTCATCCAGGTCACTAGTGAGG + Exonic
917429894 1:174955224-174955246 CCCCAGCCAAACAAGGAGTGAGG - Intronic
918806161 1:189048277-189048299 CTTCATCCAACCCACTATTGAGG + Intergenic
919856031 1:201706743-201706765 CCTGAGCCAAACCACTAATGTGG + Intronic
1062981754 10:1729469-1729491 CCTCCTCCAAACCCCAAGTCTGG - Intronic
1070283743 10:75069185-75069207 CCTCTGCCAAACCAAGATTGGGG - Intergenic
1073203089 10:101752179-101752201 TGTCATCCAAACCAGGACTGAGG + Intergenic
1075784787 10:125041764-125041786 CCTCCCCCAACCCCCGAGTGAGG + Intronic
1081832501 11:46125526-46125548 CCCCATCCAAGCTACTAGTGGGG + Intergenic
1083638147 11:64131287-64131309 CCTCACCCCACCCACGTGTGGGG + Intronic
1092748681 12:11697771-11697793 ACTCATCCAAACCAGGAGATAGG - Intronic
1096088379 12:48881959-48881981 CCTCATCCAAACCCCAAGAAAGG - Intergenic
1096979266 12:55719073-55719095 CCTCCTCCAACCCCCCAGTGTGG + Exonic
1101857140 12:108453162-108453184 CCCCATCCTGACCACCAGTGGGG + Intergenic
1106474970 13:30090564-30090586 CCTAATCCAAACCAAGACTCCGG - Intergenic
1112467180 13:99654426-99654448 CCTCATCCCAAGCCCCAGTGCGG + Intronic
1113417531 13:110139901-110139923 CTTCATCCAGGCCCCGAGTGAGG - Intergenic
1115917510 14:38332071-38332093 CCTGATCCAAACCCCAAGAGAGG - Intergenic
1122551340 14:102551817-102551839 CCTCATCCAGACCCCAAGAGAGG - Intergenic
1133359172 16:5160299-5160321 ACTCCTCCAAGCCACGAGTTTGG - Intergenic
1134903720 16:17961331-17961353 CCTGATCCAAACCCCAAGAGAGG - Intergenic
1135810168 16:25579635-25579657 CCTCATCCAGACCCAGAGAGAGG - Intergenic
1139125821 16:64075989-64076011 CATCTTTCCAACCACGAGTGAGG - Intergenic
1140833619 16:78773584-78773606 TCTCATTCCACCCACGAGTGCGG - Intronic
1141344681 16:83233885-83233907 CCTCATCTATACAAGGAGTGTGG - Intronic
1144279407 17:13709940-13709962 ACTCATCCACTCCTCGAGTGTGG + Intergenic
1146055315 17:29577958-29577980 ACTCATCCAAACCCAGAGTTTGG + Intronic
1149106363 17:52972388-52972410 CCTCATCCAGACCCCAAGAGAGG + Intergenic
1151530057 17:74698388-74698410 CATCCTCCAAGCCAAGAGTGAGG + Exonic
1153172580 18:2333100-2333122 CCTCATGAGAACCAGGAGTGAGG - Intergenic
1155896933 18:31341470-31341492 GCTCATCTAAACAACGAGTCTGG + Intronic
1161293799 19:3509266-3509288 CCTCATCCCATCCATGAATGAGG - Intronic
1162966862 19:14160285-14160307 CCTCATGCAGATCAAGAGTGGGG - Exonic
1165352015 19:35280719-35280741 CCTCATCCACACCACGTGGGAGG - Exonic
1165953645 19:39488719-39488741 ACACAGCCAAACCAAGAGTGTGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
938249721 2:129805280-129805302 CCTCATCCAAACTGGCAGTGGGG + Intergenic
945908217 2:215617809-215617831 CCTGATCCAGACCCCGAGAGAGG + Intergenic
946037095 2:216752835-216752857 CCTCATCCCAACCCAGGGTGGGG - Intergenic
1170584892 20:17727326-17727348 CCTCATCTCAATCACGGGTGTGG - Intronic
1175181441 20:57150873-57150895 CCTGATCCAGACCCCGAGAGAGG + Intergenic
1175516511 20:59573889-59573911 CCTCATGCAGAGCCCGAGTGGGG - Intergenic
1175716820 20:61260571-61260593 GCTCACCCAAGCCACCAGTGGGG - Intronic
1176117734 20:63440318-63440340 CCTCATCCAGGCCCCGAGTCGGG - Intronic
1179578645 21:42323626-42323648 CCTGATCCAAACCCCAAGAGAGG + Intergenic
953438055 3:42895602-42895624 CCTCATCTAAACCCCAAGTGGGG + Intronic
955032708 3:55236764-55236786 CCACACACATACCACGAGTGCGG + Intergenic
956356808 3:68402724-68402746 CCTCATCCAAGCCAAGAGTCTGG - Intronic
957720633 3:83993493-83993515 ACTCTTCCAAACCATGAATGTGG + Intergenic
960055278 3:113272594-113272616 CCTCATCGACACCACCAGCGAGG + Exonic
962755240 3:138461220-138461242 CCCCTTCCAAACCAAGTGTGTGG + Intronic
974373536 4:61047154-61047176 CCTCATGCAAGCCACCAATGTGG - Intergenic
975450175 4:74516670-74516692 TCTCATGAAAACCAGGAGTGTGG + Intergenic
977048029 4:92091213-92091235 CCTCATCCAGACCCCAAGAGAGG + Intergenic
978643910 4:110906242-110906264 TCTCATGGAAACCAAGAGTGGGG - Intergenic
980239934 4:130160302-130160324 CCTCATCCAGACCCCAAGAGAGG - Intergenic
981336334 4:143573058-143573080 CCACTTCCAAACCTCGAGGGAGG + Intergenic
982220257 4:153118535-153118557 CCTGATCCAGACCCCAAGTGAGG - Intergenic
983995280 4:174175061-174175083 CCCCATCCAGACCCCGAGAGAGG + Intergenic
986673123 5:10160619-10160641 CCTAATCCAGACCCCGAGAGAGG - Intergenic
989741891 5:44783539-44783561 CCTGATCCAGACCCCAAGTGAGG + Intergenic
992796732 5:80260233-80260255 CCTCATCCAGTCCACAAGAGAGG - Intergenic
1003616860 6:7662562-7662584 ATTCTTCCAAACCATGAGTGTGG - Intergenic
1008291560 6:49722061-49722083 CCTGATCCAGACCACAAGAGAGG + Intergenic
1011000357 6:82581838-82581860 ACTGATCCCATCCACGAGTGTGG + Intergenic
1022795045 7:33725263-33725285 CCTCATCTAAGCACCGAGTGTGG - Intergenic
1024484834 7:49906210-49906232 CCTGATCCACACCCCAAGTGAGG - Intronic
1026097931 7:67361588-67361610 CCCCATCCAGACCACAAGAGTGG - Intergenic
1030189491 7:106796113-106796135 CCCCATCCAGACCCCAAGTGAGG + Intergenic
1030224084 7:107129569-107129591 CCTCATCCAGACCCCAAGAGAGG + Intronic
1033020066 7:137715533-137715555 CCTCATCCAGACCACCAATTGGG + Intronic
1034094003 7:148389613-148389635 CCTGATCCAAACCCCAAGAGAGG - Intronic
1036436760 8:8742182-8742204 CCCCATCCATACCAACAGTGTGG + Intergenic
1045550527 8:103167707-103167729 CATCATGCAAGCCATGAGTGAGG + Intronic
1045785178 8:105912660-105912682 CTTCATGGAAACCAGGAGTGAGG - Intergenic
1047201881 8:122774052-122774074 CCTCCTGGAAACCAGGAGTGGGG + Intergenic
1048308779 8:133302250-133302272 ACTCATGCAAGCCAGGAGTGAGG - Intergenic
1052351998 9:27467563-27467585 CCTCATCCAAACCACGAGTGGGG - Intronic
1057160899 9:92887417-92887439 AAACATCCAAACCACAAGTGAGG + Intergenic
1061635596 9:131906684-131906706 CCTGATCCAGACCCCGAGAGAGG + Intronic
1185841837 X:3399144-3399166 CCTCATCCAGACCCCAAGAGAGG - Intergenic
1187267948 X:17754056-17754078 CTTCATCCAAACCACCCTTGCGG - Exonic
1187269753 X:17769040-17769062 CCTCATCCAGACCATGAGCAAGG - Intergenic
1189777713 X:44485116-44485138 CCTGATCCAAACCCCAAGAGAGG + Intergenic
1197276248 X:124482877-124482899 CATCATCCAAACCCCAAATGTGG + Intronic
1199679863 X:150216928-150216950 TCTCATCCTCTCCACGAGTGTGG - Intergenic