ID: 1052352094

View in Genome Browser
Species Human (GRCh38)
Location 9:27468466-27468488
Sequence CTGGTAAAGCAGAGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052352086_1052352094 22 Left 1052352086 9:27468421-27468443 CCAGCCTCGATTTCCTCAAACTT 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG No data
1052352085_1052352094 23 Left 1052352085 9:27468420-27468442 CCCAGCCTCGATTTCCTCAAACT 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG No data
1052352083_1052352094 29 Left 1052352083 9:27468414-27468436 CCCTTGCCCAGCCTCGATTTCCT 0: 1
1: 0
2: 2
3: 38
4: 307
Right 1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG No data
1052352084_1052352094 28 Left 1052352084 9:27468415-27468437 CCTTGCCCAGCCTCGATTTCCTC 0: 1
1: 1
2: 18
3: 215
4: 1543
Right 1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG No data
1052352087_1052352094 18 Left 1052352087 9:27468425-27468447 CCTCGATTTCCTCAAACTTCTCT 0: 1
1: 0
2: 1
3: 11
4: 212
Right 1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG No data
1052352089_1052352094 9 Left 1052352089 9:27468434-27468456 CCTCAAACTTCTCTCTGGCTTAA 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052352094 Original CRISPR CTGGTAAAGCAGAGGGAACA AGG Intronic
No off target data available for this crispr