ID: 1052355991

View in Genome Browser
Species Human (GRCh38)
Location 9:27505225-27505247
Sequence TCATTCTAGCAGCTGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052355991_1052355998 28 Left 1052355991 9:27505225-27505247 CCTGCATTCAGCTGCTAGAATGA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1052355998 9:27505276-27505298 TACCTAGACCTCCCCGGGAAAGG No data
1052355991_1052355995 22 Left 1052355991 9:27505225-27505247 CCTGCATTCAGCTGCTAGAATGA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1052355995 9:27505270-27505292 TGTCCGTACCTAGACCTCCCCGG No data
1052355991_1052355996 23 Left 1052355991 9:27505225-27505247 CCTGCATTCAGCTGCTAGAATGA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1052355996 9:27505271-27505293 GTCCGTACCTAGACCTCCCCGGG No data
1052355991_1052355999 29 Left 1052355991 9:27505225-27505247 CCTGCATTCAGCTGCTAGAATGA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1052355999 9:27505277-27505299 ACCTAGACCTCCCCGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052355991 Original CRISPR TCATTCTAGCAGCTGAATGC AGG (reversed) Intronic
902184694 1:14716565-14716587 TTCATCTAGCAGCTGAATCCAGG - Intronic
907752687 1:57278392-57278414 TCATTATATCATCTGAAAGCTGG - Intronic
908493407 1:64669216-64669238 TCATCCTATCAGTTCAATGCAGG - Intronic
912469206 1:109895080-109895102 GCATTCTAGGAACTGAAAGCTGG - Intergenic
917138913 1:171815104-171815126 TCACTCCAGCAGCAGAATGGAGG + Intergenic
920985416 1:210884544-210884566 TCATTCTAGGATCTGAAGTCAGG - Intronic
922436571 1:225613349-225613371 ACATTCTGGTAGCTGAATGGAGG - Intronic
1063071509 10:2671279-2671301 TCATTCTAGCTGCAGCAAGCAGG - Intergenic
1070655151 10:78266396-78266418 CAATACTAGCAGCTGAAGGCCGG + Intergenic
1070778807 10:79125864-79125886 TCAGGCTATCAGCTGAGTGCAGG + Intronic
1072130873 10:92492676-92492698 TGATTCTAGCCTCTGAATGTTGG + Intronic
1073473300 10:103737172-103737194 TCATTTCAGCAGCTGGATGTCGG + Intronic
1075413638 10:122247166-122247188 TCAGTCTGGCTGCTGAGTGCTGG + Intronic
1076279313 10:129232434-129232456 TCAGTCCAGGAGCTGACTGCTGG - Intergenic
1079259913 11:18868409-18868431 TCCTTCTAGAAACTGAGTGCTGG - Intergenic
1080795896 11:35563155-35563177 TATATCTAGCAGCTGATTGCAGG + Intergenic
1080875482 11:36270853-36270875 TCGTTCGAGCAGCTGAGTCCCGG + Intergenic
1083407830 11:62471078-62471100 TCATCCCTGCAGCTGGATGCAGG - Intronic
1083505127 11:63149618-63149640 TGATCCTAGCACCTGAATACAGG - Intronic
1085794883 11:79530104-79530126 TCATTCTAGCAGCTGTATGGTGG - Intergenic
1089139034 11:116271788-116271810 TCATCCTAGCAGCTGACTGTGGG - Intergenic
1090366793 11:126212909-126212931 TGAATCTGGCAGTTGAATGCAGG + Intronic
1092083887 12:5739939-5739961 TTATTCTATCAGCTACATGCAGG - Intronic
1096349170 12:50880433-50880455 TCATTCTAGCAGTTGCATAGTGG - Intronic
1097588011 12:61538178-61538200 TCATTCTAGCTGCTGGATGGAGG - Intergenic
1098088575 12:66875874-66875896 TCATTAAAGCAGCTAAATTCTGG + Intergenic
1098352691 12:69580923-69580945 TGATTCAAGCAGCTGAGGGCTGG + Intergenic
1100580124 12:95930861-95930883 AAATTCTAGTAGCTGAATCCTGG + Intronic
1100855425 12:98753384-98753406 TCACTGTAGCAGCTGAGAGCAGG + Intronic
1103054749 12:117809763-117809785 TCCTGCTAGGAGCTGGATGCTGG - Intronic
1104664508 12:130638040-130638062 TCATTCTAGCAACTAGATGTTGG - Intronic
1105681461 13:22732083-22732105 ACATTCTAGCAGCGGGAGGCGGG - Intergenic
1107696950 13:43009743-43009765 TCTTCCTTACAGCTGAATGCAGG - Intergenic
1107824040 13:44311594-44311616 TCAATCTCGCAGATGAATGTTGG - Intergenic
1111953807 13:94733646-94733668 TCATTCAATCAGTTGAAAGCCGG + Intergenic
1113148766 13:107238920-107238942 TCATTTTAACAGCTGTATGGGGG + Intronic
1114824508 14:26060612-26060634 TCATTCTGCCAGCTGGATGCAGG + Intergenic
1120549747 14:85855682-85855704 CCATTCTAGTAGCTGAAACCAGG + Intergenic
1121879186 14:97484855-97484877 CCATTTTCGCAGCTGAATGTGGG - Intergenic
1122196186 14:100087800-100087822 TCATTCTTCCCGCAGAATGCTGG + Intronic
1124241531 15:28032220-28032242 TGAATCTAGCACCTGAGTGCTGG - Intronic
1124558549 15:30749446-30749468 TGACTGTAGCAGCTGATTGCTGG - Intronic
1124672700 15:31656184-31656206 TGACTGTAGCAGCTGACTGCTGG + Intronic
1126273041 15:46844669-46844691 CCATTCTGGCAGCTGAAGGATGG + Intergenic
1127638201 15:60891083-60891105 TGATTCTAACAGCAGAATTCTGG - Intronic
1128146278 15:65334104-65334126 ACATTGTAGCAGCTGAGTGATGG - Intronic
1131288924 15:91087890-91087912 TGATTCTAGCAACTGAATGATGG + Intergenic
1136799196 16:33055170-33055192 TCCTTCTAGAATATGAATGCTGG - Intergenic
1137499476 16:48999249-48999271 TCATTATAGCAGCTCAAACCTGG + Intergenic
1140548846 16:75841109-75841131 TCATTCTAGCAGGAGAATGATGG + Intergenic
1142202120 16:88766229-88766251 TCATCCAATCAGCTGAAGGCAGG + Intronic
1142836286 17:2590074-2590096 TCATCCTAGCAGCTAACTGAAGG + Intergenic
1142968916 17:3598172-3598194 CCATCCTAGCAGCTGCCTGCGGG + Intergenic
1149711589 17:58747291-58747313 ACATTCTTTCAGATGAATGCAGG - Intergenic
1150106212 17:62464464-62464486 GCATTCAAGCAGCTAAAGGCAGG + Intronic
1153475810 18:5497302-5497324 TCATTCTGGCTTCTGAGTGCAGG + Intronic
1153709875 18:7787375-7787397 TGTTTCTAGCAGGTGAAAGCTGG - Intronic
1155499809 18:26475892-26475914 TCATTAAAGCAGCTCAATTCAGG - Intronic
1160715308 19:573611-573633 TCATTCTGGGTGCTGAATCCAGG - Intronic
1163263693 19:16205999-16206021 TCATTCCAGGAGCAGAAAGCAGG - Intronic
1166052226 19:40267137-40267159 TCCCTCTAGCTGCTGAATGTGGG - Intronic
1167644045 19:50696159-50696181 TTGTCCTACCAGCTGAATGCGGG - Intronic
1167783305 19:51615020-51615042 TGAATCTAGAACCTGAATGCAGG + Intronic
925690552 2:6518590-6518612 TCATCCTATCAGCTGAAGGCTGG - Intergenic
926885544 2:17595065-17595087 TCACTCCAGCAGCTGTATGGTGG - Intronic
928400458 2:30974355-30974377 TCATTCTAGCTGCAGCATGCAGG - Intronic
929279604 2:40063629-40063651 TCATCCAAGGAGCTGAAGGCAGG + Intergenic
930574946 2:53135129-53135151 TTATTCTAGCTGTTGAATGAGGG + Intergenic
931931878 2:67146982-67147004 CCACCTTAGCAGCTGAATGCTGG + Intergenic
935074363 2:99726080-99726102 TCATTATAACATCTGAAAGCAGG + Intronic
937506550 2:122543867-122543889 TCTTTCAGGCAGCTGAAAGCAGG + Intergenic
938542792 2:132299215-132299237 CCATTCTTGCAGCTGAAAGGTGG + Intergenic
941010033 2:160288937-160288959 TCATTCTAGAAGTTCAGTGCAGG + Intronic
943729950 2:191291910-191291932 TCCTGATAGCAGCTGATTGCTGG - Intronic
1171948569 20:31400492-31400514 TCATTCAAGAATCTGAAGGCAGG - Intergenic
1173007630 20:39152314-39152336 TTATTCTACCTGCCGAATGCCGG + Intergenic
1173234790 20:41234817-41234839 GCATTCTAGAAGCAGCATGCAGG + Intronic
1175698360 20:61119438-61119460 CCATTCTAGCAGCTGTGTGGTGG - Intergenic
1180963529 22:19773695-19773717 TCCTTCTAACAGGTGACTGCAGG + Intronic
1182845436 22:33427145-33427167 TCCTGCTCACAGCTGAATGCTGG + Intronic
1183209554 22:36442589-36442611 TGAGTCTGCCAGCTGAATGCTGG + Intergenic
949124690 3:433146-433168 TCATTGTAGCTGGTGAATGTGGG + Intergenic
950046974 3:9954370-9954392 AGAGTCAAGCAGCTGAATGCAGG - Intergenic
950915714 3:16643195-16643217 GCATTCTAGCAGGTCATTGCTGG + Intronic
951419176 3:22463527-22463549 TCCTGCTAGCAGCAGAATCCCGG - Intergenic
951876757 3:27435443-27435465 TCATTCTGGCAACAGAATGTAGG - Intronic
952326766 3:32327089-32327111 CTCTTCTAGCAGCTGAATGAGGG - Intronic
952355112 3:32576843-32576865 TCATTCTAACACCTGAAAGCAGG + Intergenic
953190214 3:40678936-40678958 TCAGTGTATCAGCTCAATGCTGG - Intergenic
954599394 3:51856170-51856192 CCATTCTAGCAGCTTCCTGCTGG - Intergenic
955493274 3:59504613-59504635 GCATTCTAGCAGCTTTCTGCTGG + Intergenic
955638654 3:61057947-61057969 TCACTGTAGCAGCTGAGAGCTGG + Intronic
959901576 3:111667513-111667535 TCATCCTGGGTGCTGAATGCGGG + Intergenic
960898649 3:122532172-122532194 TCATCCTCCAAGCTGAATGCAGG - Intronic
963214745 3:142732388-142732410 TGTTTCTAACAGCTGAAGGCCGG - Intronic
964529243 3:157649199-157649221 TCAGTATGGCAGCTGAATTCAGG + Intronic
966822177 3:183933644-183933666 TCATTCTAGTACCTGCATCCTGG - Intronic
969243244 4:5915834-5915856 ACATTCTAGAAGCTCAATCCAGG + Intronic
970514899 4:16818723-16818745 TCCTTCTTGGAGCTGAATCCAGG - Intronic
971356743 4:25901930-25901952 TCATTCTAGAAGGTAAGTGCAGG - Intronic
971981989 4:33763541-33763563 CCATGCTGGCAGCTGAATGATGG - Intergenic
975306971 4:72861026-72861048 TGAATCTAGTAGCTGGATGCTGG - Intergenic
975450343 4:74518258-74518280 TCAATCTAGCAGCTGAGACCTGG - Intergenic
977729819 4:100337927-100337949 TCATCTTAGCAAATGAATGCAGG + Intergenic
978092015 4:104728798-104728820 TTATACTAGCAACTGATTGCTGG - Intergenic
979015630 4:115429789-115429811 TCCTTCTAGTAGCAAAATGCTGG - Intergenic
979505226 4:121487100-121487122 TCATTCTGGCACCAGATTGCAGG - Intergenic
983465782 4:168087742-168087764 TCTTTCTAGAAGTTGAAAGCTGG - Intergenic
983846841 4:172531483-172531505 TCAATCCAGCAGCTGACAGCTGG - Intronic
986345541 5:6831833-6831855 TCATCCCACCAGCTGAAGGCTGG + Intergenic
987473915 5:18367244-18367266 TCATTCTGTCAAATGAATGCTGG - Intergenic
994108463 5:95973420-95973442 TCCTTCCAGCTGCTGAATGGTGG + Intergenic
994540751 5:101093154-101093176 GGATCCTAGAAGCTGAATGCTGG + Intergenic
999119327 5:149197033-149197055 TCATTTTTGCAGCTGAGTGATGG + Intronic
1001692175 5:173641396-173641418 TCATGCTAGCAGCTGACTTTGGG + Intergenic
1001807857 5:174603895-174603917 TTATTATAGCACCTGAAAGCAGG + Intergenic
1003667711 6:8127099-8127121 TGATTCAAGTAGATGAATGCAGG - Intergenic
1004564731 6:16785568-16785590 TCATTCTAGCATCACAAAGCAGG + Intergenic
1004647074 6:17572568-17572590 TCACACTATCAGCTGCATGCAGG - Intergenic
1005279339 6:24255742-24255764 TCATTCTAGCAGATGAGTAGTGG - Intronic
1006068700 6:31481278-31481300 TCAGTCACGCAGCTGAAAGCAGG - Intergenic
1009910329 6:69918238-69918260 TCATTCTAGCTGCTATGTGCAGG + Intronic
1021846628 7:24769382-24769404 TCATTCTTGCAGCGGGAGGCGGG + Intergenic
1022612197 7:31887042-31887064 TCAATCTAGCAGCTGAGTAGAGG + Intronic
1027947296 7:84764889-84764911 TCATTCTAGTAGCTGTGTACTGG + Intergenic
1030833829 7:114258223-114258245 TAATTCAAGAAGCTGAATTCTGG + Intronic
1031655728 7:124352146-124352168 AGGTTCTGGCAGCTGAATGCAGG + Intergenic
1032035278 7:128517052-128517074 GCATTCAAGCAGCTAAAGGCAGG + Intergenic
1032583446 7:133125101-133125123 TCATTATAGCACCTGGATTCTGG - Intergenic
1037113377 8:15193940-15193962 ATATTCTAGCAGCTAAAAGCTGG + Intronic
1042096908 8:65226250-65226272 TCATTCTAGTTGCTGCATGGAGG + Intergenic
1045485928 8:102631189-102631211 TCATTACAGCAGCTGAATGGTGG - Intergenic
1046651604 8:116842025-116842047 TCAATGTAGCAACTGAATCCGGG + Intronic
1047013863 8:120701723-120701745 CCATTCTGCCAGCTGAATCCTGG + Intronic
1052355991 9:27505225-27505247 TCATTCTAGCAGCTGAATGCAGG - Intronic
1055294345 9:74818919-74818941 TCTTTCTAGAATCTGAAGGCTGG - Intronic
1059509020 9:114826710-114826732 TCATTCTGGCAGCTGTGTGAAGG + Intergenic
1059771113 9:117426776-117426798 TCATTCAAACATCTGAAAGCAGG - Intergenic
1061889877 9:133613061-133613083 TCCATCGAGCAGCTGAATGGAGG - Intergenic
1062510602 9:136903346-136903368 TCGTTCTGGCAGCTGGATGCGGG + Intronic
1185953754 X:4465861-4465883 TCCTTCAAGCAGGGGAATGCAGG - Intergenic
1187234512 X:17454512-17454534 TCAGTTCAGCAGCTGAATGTTGG + Intronic
1187235648 X:17464654-17464676 TGATTCTTGCAGCTGGCTGCTGG - Intronic
1190100407 X:47518386-47518408 CCTCTCTAGCAACTGAATGCAGG - Intergenic
1197086111 X:122477824-122477846 TTGTTCTAGCAGCTGAATATTGG - Intergenic
1197524172 X:127541298-127541320 TCATTATATCAACAGAATGCAGG - Intergenic
1198092561 X:133346071-133346093 TCATTTTAGCCTCTGATTGCAGG - Intronic
1199726435 X:150587279-150587301 TTATTTTAACAGCTTAATGCAGG + Intronic
1199784554 X:151092661-151092683 TCCTTTTAGCAGGTGAAAGCAGG + Intergenic
1200792973 Y:7315777-7315799 GTATTCAAGCAGCTGAAAGCAGG - Intergenic