ID: 1052355994

View in Genome Browser
Species Human (GRCh38)
Location 9:27505256-27505278
Sequence GTACGGACACAGATGTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052355994_1052356007 23 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052356007 9:27505302-27505324 AGAGTGAAGGAATGACGGCCTGG No data
1052355994_1052356005 10 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052356005 9:27505289-27505311 CCGGGAAAGGGCAAGAGTGAAGG No data
1052355994_1052356006 18 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052356006 9:27505297-27505319 GGGCAAGAGTGAAGGAATGACGG No data
1052355994_1052355996 -8 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052355996 9:27505271-27505293 GTCCGTACCTAGACCTCCCCGGG No data
1052355994_1052355999 -2 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052355999 9:27505277-27505299 ACCTAGACCTCCCCGGGAAAGGG No data
1052355994_1052355995 -9 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052355995 9:27505270-27505292 TGTCCGTACCTAGACCTCCCCGG No data
1052355994_1052355998 -3 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052355998 9:27505276-27505298 TACCTAGACCTCCCCGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052355994 Original CRISPR GTACGGACACAGATGTTTGC AGG (reversed) Intronic
900609881 1:3540040-3540062 GCACGGCCACAGATGCCTGCAGG + Intronic
907410610 1:54280873-54280895 GCACGGGCACAGATGCTTGTGGG + Intronic
908088375 1:60660966-60660988 GTAAGCACTCAGATGTTTCCTGG - Intergenic
1066022209 10:31315370-31315392 ATATGGAGAAAGATGTTTGCAGG - Intergenic
1072207516 10:93217435-93217457 ATTAGGACACAGATGTGTGCAGG - Intergenic
1074086574 10:110212350-110212372 GTACAGACACAGAGGTTTCAGGG - Intronic
1074218646 10:111413352-111413374 GTCCAGACACAGCTGTTTTCTGG + Intergenic
1076807147 10:132864562-132864584 GCAGGGGGACAGATGTTTGCAGG - Intronic
1079795225 11:24793415-24793437 GTACATCCACAGATGTTTGCAGG - Intronic
1085400631 11:76233676-76233698 GTAGAGACACAGATGTGTGCAGG + Intergenic
1090314199 11:125770485-125770507 GTACTGAAACAGGTGTTTTCAGG + Intergenic
1097695904 12:62774640-62774662 CTACAGAGACAGATGTTTCCTGG - Intronic
1098161514 12:67650277-67650299 GGAAGGACAGAGATGTTTACCGG - Intronic
1100083633 12:90880810-90880832 GTACGGAGAAAGATGTACGCTGG - Intergenic
1110575136 13:77047176-77047198 GTAAGCACTCAGATGTTTGCAGG - Intronic
1112651573 13:101404813-101404835 GAAGGGGCACAGATGTTTGAAGG - Intronic
1113201947 13:107875633-107875655 GTCCGCACACACATGTGTGCCGG - Intergenic
1137747606 16:50834682-50834704 TTACGGACACAGAGGCTTCCTGG + Intergenic
1137779135 16:51082413-51082435 ATTCAGACACAGATGTCTGCAGG - Intergenic
1144831200 17:18132136-18132158 CTATGGACACACATGTATGCAGG + Intronic
1152928034 17:83096768-83096790 GTACCGGCTCAGATGTGTGCCGG + Intergenic
1156111686 18:33735178-33735200 TAAAGGACACAGATGGTTGCAGG + Intronic
1156156528 18:34309153-34309175 GTACAAAGAGAGATGTTTGCTGG + Intergenic
1156821856 18:41382798-41382820 GTATAGACACAGATGTTGGTGGG - Intergenic
1164462440 19:28460708-28460730 GCACAGACAAAGATGTCTGCTGG + Intergenic
926083841 2:10009188-10009210 AGATGGAGACAGATGTTTGCAGG - Intergenic
933936364 2:87207057-87207079 GTACAAACACAGATCATTGCAGG - Intergenic
936562342 2:113551867-113551889 GTACTCACACAAATGTGTGCCGG - Intergenic
945193328 2:207213214-207213236 CCAGGGACACAGATGTTTGTTGG - Intergenic
1169194716 20:3676990-3677012 GGACTGACACAGATCTGTGCGGG - Intronic
1169844039 20:9970761-9970783 GTGGGGACACAGATCATTGCAGG - Intergenic
1175533423 20:59690245-59690267 GCACAAACACAGATGTTTGCTGG + Intronic
1181838096 22:25627554-25627576 GTACAGTCACAGATGGTTTCAGG - Intronic
1182926480 22:34129990-34130012 GTACGGGCCCAGATGGTGGCTGG - Intergenic
955209588 3:56928375-56928397 GAACGGACCCAGATGTGTGTAGG - Intronic
961639194 3:128354216-128354238 CTGCGGACACAGAAGTTCGCAGG + Intronic
963735777 3:149016341-149016363 GTATGGGCACAGATGCTTGTAGG + Intronic
972965891 4:44509246-44509268 GTAGCCACACAGATGTCTGCGGG + Intergenic
980610042 4:135148475-135148497 GTAGGGACACAGATGAAAGCTGG - Intergenic
983928310 4:173426386-173426408 GTAGGGACACAGATATGTGGTGG - Intergenic
987221654 5:15796579-15796601 GTACAGACACAGGTAATTGCAGG + Intronic
987404043 5:17507051-17507073 GTAATGACACAGATCTTTGTTGG - Intergenic
988026627 5:25701831-25701853 GTAGGGACACAGATGTGAACTGG - Intergenic
991146189 5:63307689-63307711 GTAAGGATACACATGTTTTCTGG + Intergenic
1000041383 5:157487539-157487561 GTGCAGACACAGGTGTTTCCTGG - Intronic
1004554446 6:16682058-16682080 GTTCAGATACAGATGTTGGCAGG - Intronic
1010740412 6:79495949-79495971 GGACAGATACAGATGTTTGGAGG - Intronic
1014273182 6:119357296-119357318 GTACTGACCAAGATGTTTCCAGG + Intergenic
1025225336 7:57154844-57154866 GTAAGGAGACAGGTGTTTGGGGG + Intergenic
1031073460 7:117189280-117189302 GTAGGAACACATAAGTTTGCAGG - Intronic
1034296603 7:149978296-149978318 GGACGCACACTGTTGTTTGCAGG - Intergenic
1034809428 7:154118535-154118557 GGACGCACACTGTTGTTTGCAGG + Intronic
1044426854 8:92062271-92062293 GTACAGCCACGGATGTTTGTCGG - Intronic
1047076094 8:121405332-121405354 GTACGTTCACAGATGATTGACGG - Intergenic
1048186718 8:132248808-132248830 ATAAAGAGACAGATGTTTGCTGG + Intronic
1049890342 9:63465-63487 GTACGCACACAAATGTGTGCCGG + Intergenic
1052355994 9:27505256-27505278 GTACGGACACAGATGTTTGCAGG - Intronic
1053731804 9:41064646-41064668 GTACGCACACAAATGTGTGCTGG + Intergenic
1054696652 9:68367070-68367092 GTACGCATACAAATGTGTGCCGG - Intronic
1059666134 9:116448169-116448191 GAAGGGAAACAGATGTTTCCAGG + Intronic
1062163516 9:135093246-135093268 GTAGGGACACAGATAGTGGCAGG + Intronic
1186068071 X:5787908-5787930 GTAGAGATACAGAAGTTTGCAGG - Intergenic
1186117083 X:6315988-6316010 GTAGGAACATAGCTGTTTGCTGG + Intergenic
1186756254 X:12674307-12674329 GTATGGGAACCGATGTTTGCTGG + Intronic
1188790972 X:34408021-34408043 GTGCTGACACAGAAGTTAGCAGG + Intergenic
1189560803 X:42189628-42189650 GTTTGGACACAGATGCTTGTTGG - Intergenic
1192486159 X:71528640-71528662 CTCCGGACACAGATGTTTCTGGG - Intronic
1201968877 Y:19769610-19769632 AAATGGACACAGATCTTTGCAGG - Intergenic