ID: 1052355998

View in Genome Browser
Species Human (GRCh38)
Location 9:27505276-27505298
Sequence TACCTAGACCTCCCCGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052355991_1052355998 28 Left 1052355991 9:27505225-27505247 CCTGCATTCAGCTGCTAGAATGA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1052355998 9:27505276-27505298 TACCTAGACCTCCCCGGGAAAGG No data
1052355994_1052355998 -3 Left 1052355994 9:27505256-27505278 CCTGCAAACATCTGTGTCCGTAC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1052355998 9:27505276-27505298 TACCTAGACCTCCCCGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052355998 Original CRISPR TACCTAGACCTCCCCGGGAA AGG Intronic
No off target data available for this crispr