ID: 1052358623

View in Genome Browser
Species Human (GRCh38)
Location 9:27529853-27529875
Sequence CCACGGTGCTGCCATACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052358623_1052358628 13 Left 1052358623 9:27529853-27529875 CCTGCGGTATGGCAGCACCGTGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1052358628 9:27529889-27529911 CTTTGGGATCATCTTCCCTCCGG 0: 1
1: 0
2: 1
3: 16
4: 170
1052358623_1052358630 24 Left 1052358623 9:27529853-27529875 CCTGCGGTATGGCAGCACCGTGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1052358630 9:27529900-27529922 TCTTCCCTCCGGAAAGAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 104
1052358623_1052358627 -3 Left 1052358623 9:27529853-27529875 CCTGCGGTATGGCAGCACCGTGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1052358627 9:27529873-27529895 TGGAGAGAAAAGTCGTCTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 186
1052358623_1052358626 -4 Left 1052358623 9:27529853-27529875 CCTGCGGTATGGCAGCACCGTGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1052358626 9:27529872-27529894 GTGGAGAGAAAAGTCGTCTTTGG 0: 1
1: 1
2: 1
3: 10
4: 138
1052358623_1052358629 23 Left 1052358623 9:27529853-27529875 CCTGCGGTATGGCAGCACCGTGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1052358629 9:27529899-27529921 ATCTTCCCTCCGGAAAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052358623 Original CRISPR CCACGGTGCTGCCATACCGC AGG (reversed) Intergenic