ID: 1052358670

View in Genome Browser
Species Human (GRCh38)
Location 9:27530154-27530176
Sequence GTGGATTTACTAGAACACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052358667_1052358670 24 Left 1052358667 9:27530107-27530129 CCTGACACAGAGCGGAGCATAAA No data
Right 1052358670 9:27530154-27530176 GTGGATTTACTAGAACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052358670 Original CRISPR GTGGATTTACTAGAACACAC TGG Intergenic
No off target data available for this crispr