ID: 1052360733

View in Genome Browser
Species Human (GRCh38)
Location 9:27553762-27553784
Sequence ATATTTTTCTCCCATTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30085
Summary {0: 1, 1: 46, 2: 981, 3: 16256, 4: 12801}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052360733_1052360734 2 Left 1052360733 9:27553762-27553784 CCTACACAATGGGAGAAAAATAT 0: 1
1: 46
2: 981
3: 16256
4: 12801
Right 1052360734 9:27553787-27553809 GCAAACCATGTATCCAACAAAGG No data
1052360733_1052360739 22 Left 1052360733 9:27553762-27553784 CCTACACAATGGGAGAAAAATAT 0: 1
1: 46
2: 981
3: 16256
4: 12801
Right 1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG No data
1052360733_1052360735 3 Left 1052360733 9:27553762-27553784 CCTACACAATGGGAGAAAAATAT 0: 1
1: 46
2: 981
3: 16256
4: 12801
Right 1052360735 9:27553788-27553810 CAAACCATGTATCCAACAAAGGG No data
1052360733_1052360738 18 Left 1052360733 9:27553762-27553784 CCTACACAATGGGAGAAAAATAT 0: 1
1: 46
2: 981
3: 16256
4: 12801
Right 1052360738 9:27553803-27553825 ACAAAGGGATATGCAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052360733 Original CRISPR ATATTTTTCTCCCATTGTGT AGG (reversed) Intronic
Too many off-targets to display for this crispr