ID: 1052360736

View in Genome Browser
Species Human (GRCh38)
Location 9:27553792-27553814
Sequence ATATCCCTTTGTTGGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052360736_1052360739 -8 Left 1052360736 9:27553792-27553814 CCATGTATCCAACAAAGGGATAT 0: 1
1: 0
2: 1
3: 20
4: 178
Right 1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052360736 Original CRISPR ATATCCCTTTGTTGGATACA TGG (reversed) Intronic
903447220 1:23430410-23430432 ATATGCCATTGTTGGAGACTTGG + Intronic
903984247 1:27213863-27213885 CTTTCTCTTTGTTGGAGACAGGG - Intergenic
907322591 1:53614689-53614711 ATATTCCTTTTTTGGATTAAGGG + Intronic
909058671 1:70853124-70853146 ATATTCCTTGGGTGGAAACATGG + Intronic
909652933 1:77996157-77996179 ATATATATTTTTTGGATACAGGG + Intronic
915405159 1:155654530-155654552 ATATCCCTGTGATGTATTCAGGG - Intergenic
916428010 1:164700134-164700156 ATTTCCCTTTGTGGGTTCCAGGG + Intronic
916777309 1:167980735-167980757 TTAACCCTTTTTTAGATACATGG + Intronic
920595596 1:207266600-207266622 TTAACCCTTTGTTAGATATATGG - Intergenic
922021599 1:221710379-221710401 TTATCCCTGTTTTGTATACAGGG - Intronic
923276260 1:232399557-232399579 GTCTCCCTTTTTTGGATAGAGGG - Intronic
923423955 1:233849461-233849483 ATAGCCCTTTGCTGGATATGTGG - Intergenic
924072567 1:240297149-240297171 ATATACATTTGGTGTATACATGG + Intronic
1068264856 10:54633290-54633312 ATATCCTTTTGTGAGATGCAAGG + Intronic
1070262160 10:74867840-74867862 ATATTGCTTTGTTGAATACCTGG - Intronic
1070714805 10:78711680-78711702 AGATCCCTGTGTTAGAGACAGGG - Intergenic
1070912482 10:80130752-80130774 ATATCCCATGAATGGATACAAGG - Intergenic
1072379451 10:94852446-94852468 ATAAACATTTGTTGAATACATGG + Intronic
1081561664 11:44222875-44222897 TTAGCCCTTTGTTGGATATGTGG - Intronic
1081865484 11:46357452-46357474 ACTTCTCTTTGTTGGGTACAAGG - Intronic
1082033182 11:47621874-47621896 ATTTTCCTTTTTTGGATACAGGG + Intronic
1085497576 11:76985137-76985159 ATACCTCTTTTTTGGAGACAGGG + Intronic
1085864715 11:80277369-80277391 TTAGCCTTTTGTTAGATACATGG - Intergenic
1086342445 11:85859910-85859932 TTAGACCTTTGTTGGATGCATGG - Intronic
1086584911 11:88439804-88439826 CTATTCCTTTGTTGGATATATGG + Intergenic
1089884957 11:121811517-121811539 TTAGACCTTTGTTGGATGCATGG + Intergenic
1090309993 11:125727920-125727942 ATATCCATATGTGGGATAGAGGG - Intergenic
1090507696 11:127336627-127336649 TTATTCCTTTGTTGGATATTTGG + Intergenic
1091713334 12:2758489-2758511 ATATCCCTTAGTGGGATTGATGG - Intergenic
1093326089 12:17775955-17775977 TTAGACCTTTGTTGGATACATGG + Intergenic
1094557194 12:31512600-31512622 ATATCCCTATGTTTGAAATAAGG - Intronic
1098533027 12:71562561-71562583 TTATCCTTTTGTTGGAGACAGGG - Intronic
1098671720 12:73238578-73238600 ATATCTGTTTATGGGATACAGGG - Intergenic
1099425774 12:82521230-82521252 ATCTTCCTTAGTTGGACACAAGG - Intergenic
1100367150 12:93932365-93932387 ATATCTCTTTTTTTGAAACAGGG - Intergenic
1105061828 12:133159912-133159934 ACACCCCTTTTTTGGAGACAGGG - Intronic
1106414865 13:29538137-29538159 CTATCCCTTTGTTACATAGATGG + Intronic
1107151999 13:37122414-37122436 TTAGACCTTTGTTGGATGCATGG + Intergenic
1107804917 13:44144531-44144553 ATATCCAGTTGTTGGATGGAGGG - Intronic
1109205042 13:59473658-59473680 TTAACCCTTTGTTAGATATATGG - Intergenic
1109652364 13:65345999-65346021 TTAGTCCTTTGTTGGATGCATGG - Intergenic
1109924511 13:69119277-69119299 ATATCAATTTGTATGATACAAGG + Intergenic
1110803707 13:79730599-79730621 TTAAACCTTTGTTGGATGCATGG + Intergenic
1111192374 13:84826047-84826069 TTAGACCTTTGTTGGATACGTGG + Intergenic
1111508305 13:89225471-89225493 AAATACATTTGTTGGATATATGG - Intergenic
1111921699 13:94418883-94418905 ATATGCCTTTGTAGAATAGAGGG + Intergenic
1112225290 13:97533582-97533604 ACATCCAGGTGTTGGATACATGG - Intergenic
1112356679 13:98679342-98679364 TTATTCCTATTTTGGATACAAGG - Intergenic
1114387986 14:22275112-22275134 TTAGTCCTTTGTTGGATGCATGG + Intergenic
1118479608 14:66151120-66151142 CTAGACCTTTGTTGGATACATGG - Intergenic
1119685855 14:76630663-76630685 ATATGCCTCTATTGGAGACAGGG + Intergenic
1120252182 14:82071083-82071105 ATATCCCTTTTTGGGATATGTGG + Intergenic
1120611858 14:86651343-86651365 TTAGACCTTTGTTGGATGCAGGG - Intergenic
1121789962 14:96691652-96691674 ATATCCATTTGTCTGAGACATGG - Intergenic
1124690686 15:31819240-31819262 ATTTCTTTTTGTTGGATAAATGG + Intronic
1126871008 15:52987713-52987735 TTATCCCTTTGTTGGATGCATGG + Intergenic
1127190322 15:56523544-56523566 ATAGACCTTTGTTGGATGGATGG - Intergenic
1127886028 15:63201739-63201761 ATATCTCCTTGTTGTAGACAAGG + Intronic
1128320696 15:66691827-66691849 AGAACACTTTGTTGGGTACAGGG + Intergenic
1129088521 15:73123375-73123397 ATATCCTATTGTTGGAGAGAAGG - Intronic
1129127546 15:73457016-73457038 ATTTTACTTTGTTGGGTACAGGG + Intronic
1130112768 15:80979702-80979724 ATGTTCCTTTGTTGTATAAATGG + Intronic
1131208101 15:90468822-90468844 ATATTCCTTTTTTTGAGACAGGG - Intronic
1131355809 15:91745127-91745149 CTCTCCCTTTGCTGGATACAGGG - Intergenic
1131821145 15:96275188-96275210 AGATCCCATTGTTGGTTACATGG + Intergenic
1133383262 16:5348276-5348298 ATAAACATTTGTTGGATGCATGG - Intergenic
1134228437 16:12410451-12410473 TTATTACTTTGTTGGAGACAGGG + Intronic
1134832104 16:17332019-17332041 ATATCCCCTTGTGGGACACAGGG + Intronic
1135743033 16:24993058-24993080 AAATCCTTTTTTTGGAGACAAGG + Intronic
1137918746 16:52463764-52463786 ATACCCCTTTGTTCAATACCAGG + Intronic
1142990600 17:3728208-3728230 TTCTCCCTTTTTTGGAGACAGGG + Intronic
1143459926 17:7095974-7095996 CTAACCCTTTGTTGGATAGGTGG - Intergenic
1146222950 17:31041329-31041351 GTATCCCTTTCTTGGTAACAGGG + Intergenic
1146342050 17:32028682-32028704 GTATCCCTTTCTTGGTAACAGGG - Intronic
1146350760 17:32090913-32090935 GTATCCCTTTCTTGGTAACAGGG + Intergenic
1147876307 17:43623238-43623260 ACACCCCTTTTTTTGATACAGGG + Intergenic
1151150609 17:72082610-72082632 CTGTGCCTTTGTTGGGTACAAGG + Intergenic
1156183196 18:34630051-34630073 ATATCTCTTTTTGGGATATATGG + Intronic
1157122064 18:44920373-44920395 AGATCCCATTCTAGGATACACGG - Intronic
1157935595 18:51868891-51868913 TTAGACCTTTGTTGGATGCAGGG + Intergenic
1160279009 18:77469593-77469615 ATATCCCTGTTTTGGAAACTGGG - Intergenic
1160311135 18:77791357-77791379 AAATCCCTTTGATGGATTCAGGG - Intergenic
926498503 2:13621707-13621729 TTAGACCTTTGTTGGATCCATGG - Intergenic
926586271 2:14689240-14689262 TGATCACTTTGTTGGAGACAAGG + Intergenic
926670028 2:15568296-15568318 ATATCTCATTGGTGGGTACATGG + Intergenic
926730728 2:16033887-16033909 ATAGCCATTTGTTGGAGGCAGGG + Intergenic
930594990 2:53376628-53376650 TTAGACCTTTGTTGGATCCACGG - Intergenic
930621096 2:53644411-53644433 ATATCCCTCTTTTGGACACTTGG - Intronic
935857370 2:107289573-107289595 AAATCTCTCTCTTGGATACAGGG - Intergenic
939435620 2:142173594-142173616 ATATGCCTAACTTGGATACAAGG + Intergenic
940776051 2:157884875-157884897 ATATCCTTTTGTGGGTTCCATGG - Intronic
941890411 2:170575118-170575140 ATATTCTTTTGTTGGACACTTGG - Intronic
944581423 2:201136179-201136201 ATATTCATTTGTTGGATAGGTGG + Intronic
944788667 2:203100953-203100975 TTAGACCTTTGTTGGATGCATGG + Intronic
944932934 2:204538749-204538771 AACTCCCTCTGTTTGATACAGGG + Intergenic
947075347 2:226337834-226337856 ATAACCCTTTATCAGATACATGG - Intergenic
1169747854 20:8961513-8961535 ACATCCCTTTGGTGCAAACAAGG + Intronic
1171003056 20:21434099-21434121 ATTTCCCTTTTTTACATACATGG + Intergenic
1171106313 20:22436048-22436070 ATCTCCCTTTGTTGAATATTTGG + Intergenic
1175566927 20:59987602-59987624 ATATCCCTTCGTTGGTCTCAGGG - Exonic
1180882895 22:19219020-19219042 ATATCCCTGCTTTGGATCCAAGG + Intronic
1184933871 22:47704392-47704414 TTATCCTTTTGTTAGTTACATGG + Intergenic
955366394 3:58313855-58313877 ATAGTCCTTTGTTGGATACGTGG - Intronic
955852507 3:63235758-63235780 TTAGCCCTTTGTTGGATATGAGG + Intronic
956983702 3:74671307-74671329 ATATCCCTGTGTGGTATATAGGG + Intergenic
957183830 3:76916346-76916368 ATGTACCTTTTTTGGAGACAGGG + Intronic
957220411 3:77375203-77375225 ATATATCTTTGTTAGAGACAAGG - Intronic
958610228 3:96415695-96415717 TTAGACCTTTGTTGGATGCATGG + Intergenic
959263232 3:104106240-104106262 TTAACCCTTTGTTGAATGCATGG - Intergenic
960469565 3:118045832-118045854 TTAACCCCTTATTGGATACATGG - Intergenic
960519851 3:118642036-118642058 ATATCCCTTTGGTGATTACAGGG - Intergenic
960753891 3:120987513-120987535 CTAGTCCTTTGTTGGATATATGG + Intronic
962274650 3:134002829-134002851 ATAACTCTTTCTTGGAAACAAGG + Intronic
962333334 3:134500731-134500753 TTAGCCCTTTGTTGGATGCATGG + Intronic
964963848 3:162464484-162464506 TTAGACCTTTGTTGGATGCATGG + Intergenic
965553089 3:169990106-169990128 ATATTCATTTTTTGGAGACAGGG + Intronic
965578236 3:170240153-170240175 ATATCTTTTTTTTGGAAACAGGG - Intronic
967455239 3:189677995-189678017 TTATTCCTTTGTAGGATGCATGG + Intronic
969332529 4:6486119-6486141 ATTTCCCTTTCTTGGACACATGG + Intronic
970636464 4:18015252-18015274 ACATCCCTTGTTTGGCTACATGG - Intronic
970856661 4:20657067-20657089 TTATTCCTTTGTTGAATGCATGG - Intergenic
972452183 4:39212691-39212713 CTAGCCCTTTGTTGGATACGTGG - Intronic
978633743 4:110778935-110778957 TTAGACCTTTGTTGGATGCATGG + Intergenic
981554242 4:145975501-145975523 CTAATCCTTTGTTGGATATATGG - Intergenic
983667677 4:170200096-170200118 TTAGACCTTTGTTGGATGCATGG - Intergenic
984151573 4:176139630-176139652 ATTTCTTTTTGTTGGATACAAGG - Intronic
985567796 5:629138-629160 AACTGCCTTTGTTGGAAACAAGG + Intronic
986125703 5:4880787-4880809 ATAAACCTTTGTTGGATGAAGGG + Intergenic
986503371 5:8425176-8425198 CTATTTCTTTGTTGGATTCATGG + Intergenic
987801950 5:22709556-22709578 ATATTCTTCTGTTGTATACATGG + Intronic
988424073 5:31042236-31042258 TTAGTCCTTTGTCGGATACATGG - Intergenic
988862049 5:35291958-35291980 TTAACCCTTTATTGGATACATGG + Intergenic
990973065 5:61530771-61530793 ATGTCCCTTTGTTGCTTCCATGG + Intronic
991487008 5:67147854-67147876 ATCTCCCTTTGTTGGTCAGATGG + Intronic
993082091 5:83314223-83314245 ACATCCCTTTGTTAGAGAAAGGG - Intronic
994467272 5:100153828-100153850 GTAGGCCTTTGTTGGATGCAAGG - Intergenic
995147497 5:108803228-108803250 TTAGTCCTTTGTTGGATGCATGG + Intronic
996752364 5:126901778-126901800 ATTGCCCTGTGTTGGGTACAAGG - Intronic
997149916 5:131482314-131482336 ATATGCATTTTTTGGAAACAGGG + Intronic
999184172 5:149693206-149693228 ACATCCATTTGTTGGATGGATGG - Intergenic
1000250828 5:159493392-159493414 ATATCCCTATTTTGGAGACAAGG - Intergenic
1000540090 5:162528982-162529004 ATATAACTTTATGGGATACATGG - Intergenic
1000966686 5:167666095-167666117 ATTTCCTTTTGCTGGGTACAGGG + Intronic
1001924885 5:175628742-175628764 ATATCCTTGTTTTGGAGACAGGG - Intergenic
1001944235 5:175765356-175765378 CTAGTCCTTTGTTGGGTACATGG - Intergenic
1002886713 6:1303368-1303390 TTAGTCCTTTGTTGGATTCATGG - Intergenic
1003277345 6:4664005-4664027 ATATCCCTTTTTTTGAGACAGGG - Intergenic
1004919988 6:20367279-20367301 TTATCCCTTTGTATGATTCAAGG + Intergenic
1009757716 6:67961229-67961251 ATATCCAACTGTTGGATATAAGG - Intergenic
1010127194 6:72446823-72446845 ATATACCTTTTTTATATACATGG + Intergenic
1012246633 6:96933410-96933432 AGACTCCTTTGTTGGATGCAGGG + Intronic
1012424309 6:99097317-99097339 ATAGTCCTTTGTTGGATGCATGG - Intergenic
1012828852 6:104181235-104181257 TTCTCCCTATGTTGGAGACATGG - Intergenic
1012872724 6:104691540-104691562 ATTTCCCTTTTTTGTATACTAGG - Intergenic
1015384785 6:132609551-132609573 ATAAACCTATGTTGGATAGATGG - Intergenic
1015661286 6:135576736-135576758 ATACCCATTTGTTAGATACTGGG + Intergenic
1016911086 6:149200018-149200040 AGATCCCTTCCTTGGAGACAAGG - Intergenic
1018496589 6:164353608-164353630 TTAAACCTTTGTTGGATGCATGG + Intergenic
1018945037 6:168341902-168341924 ATATCTATTAGTTGGAAACAGGG - Intergenic
1021324651 7:19251654-19251676 AAACCCCTTTGTTGCATATATGG - Intergenic
1021780930 7:24105056-24105078 TTAATCCTTTGTTGGATACGTGG + Intergenic
1028908178 7:96178025-96178047 CCATCCCTTTGTTGTGTACAAGG - Intronic
1031092788 7:117381057-117381079 ATATCCCTTTCCTGTATAAAAGG + Exonic
1031772245 7:125858763-125858785 ATATTACTTTGTTAGATAAATGG + Intergenic
1033681909 7:143603212-143603234 ATATCCCAGTGTGGGAGACAGGG - Intergenic
1033702980 7:143858701-143858723 ATATCCCAGTGTGGGAGACAGGG + Intronic
1036110748 8:5898771-5898793 ATATTGCTTTGTTGTTTACATGG - Intergenic
1037498565 8:19463872-19463894 AGATCTCTGTCTTGGATACATGG - Intronic
1042467734 8:69147459-69147481 ATATCACTTTGATGCATTCATGG + Intergenic
1042675464 8:71316419-71316441 GTATCCTTTTGATGGCTACATGG - Intronic
1042740153 8:72034599-72034621 TTATCTATTTTTTGGATACAGGG + Intronic
1044263695 8:90157963-90157985 ATAACTTTTTGTTGAATACACGG - Intergenic
1044367940 8:91372130-91372152 TTAGTCCTTTGTTGGATGCATGG + Intronic
1046875696 8:119252337-119252359 ATGTCCCTTTGGTTCATACATGG - Intergenic
1047783715 8:128133377-128133399 ATTTGCATTTGTTGGGTACATGG + Intergenic
1048390500 8:133959136-133959158 GTATTCCTATGTTGGGTACATGG - Intergenic
1048676396 8:136787455-136787477 ATATACTTGTGTTGGATACTTGG - Intergenic
1050816570 9:9820381-9820403 TTAGGCCTTTGTTGGATGCATGG + Intronic
1052360736 9:27553792-27553814 ATATCCCTTTGTTGGATACATGG - Intronic
1054723878 9:68630872-68630894 ATATCTGTATGTTGGATTCATGG - Intergenic
1055558709 9:77501593-77501615 CTAGCTCTTTGTTGGATATATGG + Intronic
1057397103 9:94690010-94690032 GCATCCCTTGGTTGGAGACATGG - Intergenic
1059378467 9:113904996-113905018 ACATGTCTTTGTTGGGTACAGGG + Intronic
1061186563 9:129058222-129058244 ATATATCTTTGGTAGATACAGGG - Intronic
1187654630 X:21457116-21457138 TTAACCCCTTATTGGATACATGG + Intronic
1187851568 X:23596237-23596259 ATATCCATTTTTTTGAGACAGGG - Intergenic
1188221138 X:27542882-27542904 CTAGACCTTTGTTGGATGCACGG + Intergenic
1189297970 X:39932154-39932176 GTATACCTTTGTTGGAGAAAAGG - Intergenic
1192728635 X:73779203-73779225 ATATCTCTGTGTTGTCTACAAGG + Intergenic
1195173200 X:102289109-102289131 TTAGTCCTTTGTTGGATGCAGGG + Intergenic
1195185666 X:102397987-102398009 TTAGTCCTTTGTTGGATGCAGGG - Intronic
1195717592 X:107831948-107831970 AAATCCATTTGTTGGTTACTTGG + Intronic
1196094406 X:111783656-111783678 CAATCCCTTTGTTAGATATATGG + Intronic
1196534474 X:116826190-116826212 CTATCCCTTTTTTCTATACACGG - Intergenic
1196776700 X:119344507-119344529 AAATCCCTTTTTTGGAGACAGGG - Intergenic
1196782700 X:119397791-119397813 AAAGCCCTTTGTTGGATAACGGG - Intergenic
1197132162 X:123018259-123018281 TTAGACCTTTGTTGGATGCATGG + Intergenic
1198668520 X:139051888-139051910 ATATTCCATTGTTGGATTGATGG - Intronic
1200310172 X:155070578-155070600 GTAGCTATTTGTTGGATACAGGG - Intronic
1201501019 Y:14642763-14642785 ATATCCCTCCATTGGAGACATGG - Intronic