ID: 1052360739

View in Genome Browser
Species Human (GRCh38)
Location 9:27553807-27553829
Sequence AGGGATATGCAGAATCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052360736_1052360739 -8 Left 1052360736 9:27553792-27553814 CCATGTATCCAACAAAGGGATAT 0: 1
1: 0
2: 1
3: 20
4: 178
Right 1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG No data
1052360733_1052360739 22 Left 1052360733 9:27553762-27553784 CCTACACAATGGGAGAAAAATAT 0: 1
1: 46
2: 981
3: 16256
4: 12801
Right 1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052360739 Original CRISPR AGGGATATGCAGAATCTGGA AGG Intronic
No off target data available for this crispr