ID: 1052362191

View in Genome Browser
Species Human (GRCh38)
Location 9:27573365-27573387
Sequence CGGCTGCCGGGAAGAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052362191_1052362197 1 Left 1052362191 9:27573365-27573387 CCCGCGCCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 4
3: 20
4: 231
Right 1052362197 9:27573389-27573411 ACCCCAAACAGCCACCCGCCAGG 0: 1
1: 0
2: 2
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052362191 Original CRISPR CGGCTGCCGGGAAGAGGCGC GGG (reversed) Intronic
900227652 1:1540489-1540511 CGGCCGGGGGGAGGAGGCGCGGG + Intergenic
900524215 1:3120605-3120627 GGGCTGCCGGGGACAGGGGCAGG - Intronic
900633939 1:3652633-3652655 CGGCTGCAGGTAGGAGGCCCAGG + Exonic
900968951 1:5978705-5978727 CGCCTGCCAGGATGAGGCCCAGG + Intronic
903372642 1:22846841-22846863 AGCCTGTGGGGAAGAGGCGCTGG - Intronic
903813128 1:26045902-26045924 CGGCTGCCGGGACTCGGCGCGGG - Exonic
904311581 1:29632776-29632798 GGGCTGAGGGGAAGAGGGGCTGG - Intergenic
904613858 1:31739381-31739403 GGTCTGCTGGGAGGAGGCGCTGG + Exonic
904928543 1:34067519-34067541 GGGCTGCCAGGAAGAGCCTCAGG + Intronic
905863858 1:41366440-41366462 CGGCGGCGGGGGAGGGGCGCCGG - Intronic
906144859 1:43553969-43553991 GGGCTGCCGGGCTGAGGCGTGGG + Intronic
906962703 1:50428012-50428034 CGCCTGCCCGGAAGACGCGAGGG - Intergenic
910863328 1:91764574-91764596 CGGCTGCGGAGAAGAGAGGCAGG + Intronic
912927965 1:113929885-113929907 GGGCTGCCGTGAGGAGGCGGCGG - Exonic
913714456 1:121519552-121519574 GGGTTGGCGGGGAGAGGCGCGGG + Intergenic
914377159 1:147081420-147081442 AGGCTTCAGGGAAGAAGCGCAGG - Intergenic
914919639 1:151838575-151838597 CGGGGGCCCGGCAGAGGCGCAGG + Exonic
915307614 1:154989678-154989700 CAGCTGCATGGAAGAGGTGCAGG - Exonic
915559382 1:156677448-156677470 AGGCGGGCGGGAAGAGGGGCGGG + Intergenic
917359351 1:174159476-174159498 CGCCTGGCAGGAAGAGGCGAGGG - Intronic
920224696 1:204429992-204430014 CCGCTCCCGGGGAGAGGCGGTGG - Exonic
924436687 1:244048917-244048939 CGGCGGCCGGGAGGAGGAGGAGG + Intronic
1063623383 10:7667672-7667694 CTGAGGCCGGGAAGCGGCGCCGG - Intergenic
1063776843 10:9273617-9273639 GGGCGGCCGGGCAGAGACGCTGG + Intergenic
1066180484 10:32957581-32957603 CGGCTGCCAGGAGGCGGCCCTGG - Intronic
1070753001 10:78974830-78974852 TGTCAGCCGGGAAGAGGCGAGGG + Intergenic
1071566751 10:86675071-86675093 CAGCTGCAGGGGAGAGGCACTGG + Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1073036468 10:100567334-100567356 CGGCTGCAGGGAACAGGCCTAGG + Intergenic
1073057205 10:100710334-100710356 CGGCGCCCGGGAGGAGCCGCGGG - Intergenic
1077194440 11:1272272-1272294 CGGGTGCCGGTGAGAGGAGCAGG - Intergenic
1077584904 11:3443823-3443845 AGGCTGCCTGGAAGGGACGCGGG + Intergenic
1078210366 11:9265227-9265249 CGGCTGCCGTGACGGGGCGGGGG + Exonic
1081743270 11:45455674-45455696 CGGCGGCCAGGAGGAGGAGCTGG - Intergenic
1083753702 11:64778096-64778118 CGGCGGCGGGTACGAGGCGCCGG + Exonic
1083795442 11:65014180-65014202 CGGCGGCCGGGAGGGGGCTCCGG + Exonic
1084241805 11:67826391-67826413 AGGCTGCCTGGAAGGGACGCAGG + Intergenic
1084285490 11:68128266-68128288 CGGCGGCGGGGAGGAGGGGCAGG + Intergenic
1084415875 11:69032748-69032770 AGGCTTCCGGGAACAGGAGCAGG + Intergenic
1089148403 11:116346941-116346963 TGGCGGCCGGGAAGAGGTGCGGG - Intergenic
1089326980 11:117664050-117664072 CAGCAGCCGGGAGGAGGGGCCGG + Intronic
1090937184 11:131353678-131353700 CTGCTGCGGGGCAGAGGCTCTGG - Intergenic
1091222423 11:133937175-133937197 CGGCTGCCTGGGAGAGGGCCAGG - Intronic
1091401392 12:182630-182652 CGGCTGCTGGGAAGACGACCTGG + Intergenic
1091550051 12:1530277-1530299 CGGGGGCGGGGAGGAGGCGCGGG + Intronic
1104857333 12:131908316-131908338 TGGATGCCGGGAAGAGGGGCAGG + Intronic
1104920200 12:132286502-132286524 CGGCCGTCGGGGAGAGGGGCGGG - Intronic
1105844592 13:24283141-24283163 AGGCTTCCTGGAAGAGGAGCAGG - Intronic
1107853279 13:44591454-44591476 CGGTTGCCGGTGCGAGGCGCTGG + Intergenic
1110119629 13:71865872-71865894 AGGCTGGTGGGAAGGGGCGCGGG + Intronic
1110451748 13:75644395-75644417 CTGCTGCCTGGGAGTGGCGCTGG + Intronic
1114183983 14:20386418-20386440 GGGCTGCAGAGAAGAGGGGCTGG - Intronic
1114372104 14:22100933-22100955 GGGCGGCCGGGCAGAGGCGCTGG + Intergenic
1119090095 14:71773211-71773233 CGGCTCCCTGGAGGAGGGGCTGG + Intergenic
1119225600 14:72942611-72942633 CGGCTGCCGGGAAGAGCCCCAGG - Intronic
1119225607 14:72942637-72942659 CCGCTGCTGGGAAGAGCCCCAGG - Intronic
1119747113 14:77052473-77052495 AGGCTCCCCGGAAGAGGGGCAGG + Intergenic
1121309905 14:92930051-92930073 CGTCTGCCCAGAAGAGGGGCTGG + Intronic
1121465964 14:94115761-94115783 CAACTGCAGGGAAGAGGAGCTGG - Exonic
1122275224 14:100587480-100587502 GCGCTGCCGGGAGGACGCGCGGG - Intergenic
1122784717 14:104158393-104158415 GGGCTGCCCGGGGGAGGCGCAGG + Intronic
1122812011 14:104293752-104293774 GGGCTGCCAGGAAGGGGCCCTGG + Intergenic
1122940773 14:104980421-104980443 CCACTGCTGGGAAGAGGCCCTGG + Intergenic
1123024506 14:105418460-105418482 GGGCTGCAGGGAACAGGAGCTGG - Intronic
1124999378 15:34754771-34754793 CGGACGCCGGGACGAGGGGCGGG + Exonic
1126134695 15:45378613-45378635 TGGCTGCCGGGAACAGGTGGTGG + Exonic
1127165700 15:56243574-56243596 CCGCTGACGGGAGGAGGCGGCGG - Intergenic
1129612421 15:77071151-77071173 CGGTTGCCAGGGAGCGGCGCGGG - Exonic
1129856879 15:78831022-78831044 CAGCTGGCCGGAAGAGGCGTCGG + Intronic
1131277630 15:90994904-90994926 CGGCTGCCGGGAACGGGCGCGGG + Intronic
1132654485 16:1036182-1036204 GGCCTGGCGGGAAGAGGCCCCGG + Intergenic
1132702249 16:1226820-1226842 TGGCTGCCGGCAGGAGGCCCTGG - Intergenic
1132706072 16:1244048-1244070 TGGCTGCCGGCAGGAGGCCCTGG + Intergenic
1132799733 16:1746089-1746111 CGGCTGCCTGGGACAGGCACAGG + Intronic
1132933801 16:2471315-2471337 CTGCAGCCGGGAGGAGGCGGCGG + Intergenic
1133304049 16:4799012-4799034 GGGCTTCCTGGAAGAGGCGATGG + Intronic
1133346935 16:5077554-5077576 CGGCGGCCTGGGAGAGGCGCGGG + Intronic
1133680393 16:8115124-8115146 TGGCGGCCGGGAAGAGGCGCTGG - Intergenic
1136129722 16:28211992-28212014 CGGCCGCCGGGCTGCGGCGCTGG + Intergenic
1137767803 16:50991389-50991411 AGGCTGCAGGGAAGTGGAGCCGG - Intergenic
1142018516 16:87765629-87765651 GGGCTGCCCGGACGCGGCGCCGG + Intronic
1143185656 17:5008526-5008548 GGGCTGCCTGGAAGAGGTGATGG + Intronic
1143443993 17:6996467-6996489 GGGCTGCCGGGACCAGGGGCGGG - Intronic
1144862556 17:18314794-18314816 CGGCAGCCGGGGAGCGGCTCCGG - Exonic
1149891247 17:60392087-60392109 CGGCGACCGGGAGGAGCCGCCGG - Exonic
1150373587 17:64662152-64662174 CGGCGGCCGCGAGGAGGCGGCGG - Intergenic
1150692769 17:67378926-67378948 CGGCTGCCGGCTGGGGGCGCCGG + Intronic
1151476677 17:74348065-74348087 CGGCTTCCCGGCAGAGGAGCAGG - Intronic
1151661613 17:75521947-75521969 CGGGAGCCGGTAAGCGGCGCTGG + Exonic
1152356403 17:79809788-79809810 CGGGGGCCGGGGGGAGGCGCCGG - Intergenic
1155284273 18:24272065-24272087 CCGCTGGCGGGCGGAGGCGCAGG + Intronic
1155972050 18:32092270-32092292 GGGGTGCCGGGAAGCGGGGCGGG + Intronic
1156239674 18:35240922-35240944 CGGCTACCGGGAGAAGGCGGTGG + Intergenic
1158893726 18:61894737-61894759 GGGCAGCCGGGAGGAGGGGCAGG + Intergenic
1160389192 18:78517677-78517699 CCGCTTCCGGGACAAGGCGCCGG - Intergenic
1160389205 18:78517718-78517740 CCGCTTCCGGGACAAGGCGCCGG - Intergenic
1160389218 18:78517759-78517781 CCGCTTCCGGGACAAGGCGCCGG - Intergenic
1160592306 18:79951437-79951459 CGGCTCGCGGGAGGAGGTGCCGG + Intronic
1160597616 18:79988169-79988191 CGCCGGCAGGGCAGAGGCGCGGG + Intronic
1161028195 19:2046281-2046303 CGTCTGCCGGGCAGCGGGGCGGG + Exonic
1161031850 19:2061329-2061351 CGGCCGCCGGGAGGAGGAGGAGG - Intergenic
1161104539 19:2436862-2436884 CAGGGGCCGGGAAGAGGCCCTGG - Intronic
1161125019 19:2550919-2550941 CGGCTGCTGGGAACAGGGCCAGG + Intronic
1161186693 19:2926318-2926340 CGGCTGCCGGGAGAAAGAGCTGG + Intergenic
1161447087 19:4324455-4324477 CGGCTGTGGGGAAGAGAGGCTGG + Exonic
1161518499 19:4710472-4710494 CTGCTGCTGGGAAGATGGGCTGG - Intronic
1161845464 19:6709643-6709665 AGGCTGCTGAGAAGAGGCGGAGG - Intronic
1162128150 19:8510613-8510635 GGGCTGCAGGGAAGGGGGGCTGG - Exonic
1162128454 19:8511665-8511687 CAGCGGCCAGGAAGGGGCGCAGG + Exonic
1164693585 19:30227721-30227743 CGGCTGCCGGGAGAAGGCGCAGG - Intergenic
1166197971 19:41219230-41219252 CGGCTGCTGGGCAGAGCCGGTGG + Exonic
1166422562 19:42650363-42650385 CAGCTGCCTGGAACAGGAGCAGG + Intronic
1166496679 19:43307903-43307925 CAGCTGCCTGGAACAGGAGCAGG - Intergenic
1168075341 19:53978295-53978317 TGGGTGCCGGGAAAAGGCACTGG + Intronic
1168247001 19:55117475-55117497 CGGCTGCCCGGGAGCGGCGACGG - Exonic
927472316 2:23385554-23385576 GGGCTGCCGGGAGGCGGCGGCGG + Exonic
928009531 2:27594533-27594555 GGGCGGCCGGGCAGAGGCGCTGG + Intronic
928904635 2:36356258-36356280 CGGCTGCGAGGAGGAGGCGGCGG + Exonic
933666852 2:84971265-84971287 CGGCGGCGGGGAGGCGGCGCGGG - Exonic
934954834 2:98608664-98608686 CGGCTGCTGGGAGGAGGTGGTGG + Exonic
936014296 2:108946109-108946131 CGACTGCCAGGAGGAGGGGCTGG - Intronic
937917360 2:127105778-127105800 CGGCCGCCGGGTGGAGGCGCAGG - Intronic
938251194 2:129816994-129817016 GGGCTGCCAGGAGGAGGCTCTGG + Intergenic
942448170 2:176092357-176092379 CGGTTGCCGAGACAAGGCGCAGG + Intergenic
943578018 2:189653568-189653590 GGGCAGCGGGGCAGAGGCGCTGG - Intergenic
945037242 2:205714888-205714910 CGGCTGCCGGAAGGAGTGGCTGG - Intronic
946326129 2:218985461-218985483 CCGCAGCCGGGGAGACGCGCGGG + Exonic
947573097 2:231250674-231250696 GGGCTGCCAGGGAGAGGAGCTGG + Intronic
948467383 2:238158878-238158900 CGGGAGCCGGGAGGGGGCGCGGG + Intergenic
948592843 2:239062402-239062424 AGGCTGCCGGGCAGAGGGGCGGG + Intronic
948854989 2:240725926-240725948 AGGTTGCCGTGAGGAGGCGCTGG - Intronic
1172123219 20:32610643-32610665 CGGGTGCCCGGAAGTGGCTCGGG + Intergenic
1172146650 20:32762409-32762431 CTGCTGCGAGGAAGCGGCGCGGG - Exonic
1172993087 20:39050235-39050257 CGGCGGCCGGCAGGCGGCGCTGG + Intergenic
1173253618 20:41377434-41377456 AGGCTGGAGGGAAGAGGGGCAGG + Intergenic
1173939166 20:46895071-46895093 CGAGTGCCAGAAAGAGGCGCAGG - Intronic
1174609879 20:51790336-51790358 TGGATGCTGGGAAGAGGCGTGGG + Exonic
1175404995 20:58720144-58720166 CGGCTTCCGGAAGGAGGAGCCGG + Intergenic
1175593994 20:60215854-60215876 AGGCTGCTGGGAGGAGGAGCAGG + Intergenic
1175720292 20:61281590-61281612 TGGCTGCCGGGAGGCGGGGCTGG - Intronic
1175782791 20:61694218-61694240 AGGGTGTCGGGAAGAGGCGCAGG + Intronic
1176059481 20:63166143-63166165 CGGCTTCCAGGAGGAGGCCCTGG - Intergenic
1176242936 20:64083492-64083514 CCGCTGCCGGGGAGAGAGGCTGG + Exonic
1179655465 21:42841908-42841930 CCTCTGCCGGGAAGAGGTCCTGG + Intergenic
1180762268 22:18219841-18219863 CGGGTGCGGGGAGGGGGCGCAGG - Intergenic
1180773399 22:18404767-18404789 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
1180804750 22:18654316-18654338 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
1180805994 22:18715094-18715116 CGGGTGCGGGGAGGGGGCGCAGG - Intergenic
1180841738 22:18962133-18962155 TGGCTGCCTGGAGGAGGGGCTGG - Intergenic
1181059764 22:20276728-20276750 TGGCTGCCCGGATGAGGGGCTGG + Intronic
1181192495 22:21151700-21151722 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
1181216944 22:21340875-21340897 CGGGTGCGGGGAGGGGGCGCAGG - Intergenic
1181362007 22:22344698-22344720 CGGCTGTTGGGAACAGGCACAGG - Intergenic
1181419143 22:22785786-22785808 TGCCTGCCTGCAAGAGGCGCTGG - Intronic
1181978901 22:26752351-26752373 GGGCAGCCAGGAAGAGACGCTGG - Intergenic
1184730064 22:46366979-46367001 CTGCTGACGGTAGGAGGCGCCGG - Exonic
1185169732 22:49285775-49285797 AGGCTGCGTGGGAGAGGCGCTGG - Intergenic
1203235229 22_KI270731v1_random:145749-145771 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
950386350 3:12663684-12663706 CGGCTGCCGGGCAGAGGGCTTGG - Intronic
960602178 3:119469184-119469206 CGGCTCCCGGGAAGATGCCGTGG + Intronic
960610619 3:119551912-119551934 CTGCTGCTGGGTAGAGGTGCAGG - Intronic
960840799 3:121956590-121956612 CGCCTGGCAGGAAGAGGCACAGG + Intergenic
960998299 3:123353718-123353740 CGGCTGCCTGGCAGTGGCCCTGG + Intronic
962314434 3:134350463-134350485 GGGCTGCAGGAAAGAGGCACAGG + Intergenic
966849342 3:184155287-184155309 CGGCCGCCGCGGAGAGGCGCCGG - Intronic
968061546 3:195729793-195729815 GGGCTGCAGGGAAGACCCGCAGG + Intronic
968405719 4:337792-337814 TGGCTTCCGGGATGTGGCGCGGG + Intronic
968473508 4:792333-792355 GGGCTGCCCGGAAGAGGGGCGGG - Intronic
969000099 4:3973666-3973688 AGGCTGCCTGGAAGGGACGCGGG + Intergenic
969294676 4:6262940-6262962 CGGCTCCCTGGAGGAGGTGCTGG - Intergenic
972162570 4:36244485-36244507 CGGCGGCCGAGGCGAGGCGCGGG - Exonic
972904376 4:43727517-43727539 CTGCTGCGGGGAGGCGGCGCAGG - Intergenic
975702028 4:77075792-77075814 CGGGGGCCGGGGAGAGGCGGGGG + Exonic
982033621 4:151325227-151325249 CGGCCGCAGGTGAGAGGCGCGGG - Intronic
984439297 4:179746377-179746399 CGGCTGCTGGGAAGGAGTGCAGG + Intergenic
986152401 5:5139982-5140004 AGGCTGCCGGGCACCGGCGCGGG - Intergenic
989963288 5:50440925-50440947 AGGGTGGCGGGGAGAGGCGCGGG - Intronic
990381237 5:55223449-55223471 CGGCTGCCCGGAGCCGGCGCAGG - Intronic
990941229 5:61205116-61205138 AGGTGGCCGGGCAGAGGCGCTGG - Intergenic
995506053 5:112861545-112861567 GAGCTGCCAGGGAGAGGCGCGGG - Intronic
997602702 5:135151211-135151233 CAGCAGCCAGGAAGAGGCACAGG - Intronic
1000432339 5:161166248-161166270 CGGCTGGCGGGGGGAGGCTCAGG + Intergenic
1002082107 5:176743356-176743378 GGGCTGCGGGGAGAAGGCGCGGG + Intergenic
1002927134 6:1611156-1611178 CGGCGGCCGGGGACAGGGGCTGG - Exonic
1004709384 6:18155450-18155472 CGGCGGCCGAGAAGAGGCTGGGG + Exonic
1006313407 6:33277127-33277149 CGGCCGCCGGGGCGAGGCGGGGG + Exonic
1006458333 6:34144407-34144429 CGGCGGCCGCGTAGACGCGCAGG + Intronic
1007635695 6:43298466-43298488 CGGCAGCCAGGAAGATGGGCAGG - Exonic
1007652666 6:43432910-43432932 GGGCTTCCTGGAAGAGGGGCAGG + Exonic
1007783782 6:44268931-44268953 CGGCTGTCCAGAAGAGGCGGGGG - Intergenic
1012625897 6:101402750-101402772 CGCCTGCCTGGGAGAGTCGCAGG - Intronic
1015440764 6:133242924-133242946 GGGATGGCGGGGAGAGGCGCAGG - Intronic
1016949444 6:149566253-149566275 GGGCGGCCGCGGAGAGGCGCGGG - Intergenic
1017485369 6:154897407-154897429 CGGCTTCCGTGAAGAGGTACAGG + Intronic
1018070716 6:160161942-160161964 CACCTGCTGGGAAGAGGTGCAGG - Intergenic
1019111913 6:169723968-169723990 CGGCGGCCGGGACAAGGCGGAGG - Exonic
1019354450 7:571420-571442 CGTCGGCGGGGAGGAGGCGCGGG + Intronic
1020098148 7:5379849-5379871 GGGCTTCCGGGAAGAGGGGTGGG + Intronic
1022103790 7:27184529-27184551 CGGCTGCCGGGAGACGGCGGCGG - Exonic
1022173280 7:27849776-27849798 GGGCGGCCGGGAAGAGGTGTAGG - Intronic
1022943241 7:35258545-35258567 CCACTGCCGGGAGGAGGCCCGGG - Intergenic
1023881786 7:44325107-44325129 CGGCTGCCGGGCCGGGGCTCCGG - Intronic
1024985862 7:55192609-55192631 CTGTTGCCGGGAGGAGGCGCCGG + Intronic
1025177831 7:56810904-56810926 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025177989 7:56811550-56811572 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025178407 7:56813241-56813263 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025178837 7:56814983-56815005 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025179274 7:56816773-56816795 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025179732 7:56818659-56818681 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025180181 7:56820497-56820519 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025180652 7:56822479-56822501 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025181096 7:56824326-56824348 AGGCTGCCGGGAGGAAGCGCTGG + Intronic
1025181526 7:56826068-56826090 AGGCTGCCGGGAGGAAGAGCTGG + Intronic
1025181970 7:56827910-56827932 AGGCTGCCGGGAGGAAGAGCTGG + Intergenic
1025231060 7:57203598-57203620 CTGCTGCCGAGCAGAGGAGCGGG - Intergenic
1029587800 7:101486540-101486562 CAGCTGCAGGGAAGAGGACCGGG + Intronic
1034228009 7:149497749-149497771 CGTCTGCCGGGCCGCGGCGCCGG - Exonic
1034270289 7:149800357-149800379 GGGCTGCGTGGAACAGGCGCAGG + Intergenic
1034429915 7:151036100-151036122 CCGCTGCCGGGCAGAGGAGCTGG + Exonic
1034478727 7:151303686-151303708 CAGCAGCCGGGAAGGGGCGAGGG + Intergenic
1035031249 7:155862578-155862600 CGTCTGCCAGGAAGACGTGCAGG - Intergenic
1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG + Exonic
1036377139 8:8210290-8210312 AGGCTGCCTGGAAGGGACGCGGG - Intergenic
1036852410 8:12212859-12212881 AGGCTGCCTGGAAGGGACGCGGG + Intergenic
1036873778 8:12455382-12455404 AGGCTGCCTGGAAGGGACGCGGG + Intergenic
1042183426 8:66113831-66113853 CGGCTGCCGTGAGGAGGTGGGGG + Intergenic
1045111571 8:98942137-98942159 CGCCGGCCGGGACGAGGGGCTGG + Intronic
1045510856 8:102810840-102810862 GGTCGGCCGGGGAGAGGCGCGGG + Intergenic
1047259664 8:123244271-123244293 GGGCTGCCTGGAGGAGGTGCTGG - Intronic
1048455016 8:134569946-134569968 AGGGTGCTGGGAAGAGGAGCAGG - Intronic
1048881709 8:138877248-138877270 GGGCTGCTGGGAAGAGCCGAGGG + Intronic
1049213901 8:141399043-141399065 AGGCTTCCTGGAAGAGGCTCGGG + Intronic
1049241727 8:141540778-141540800 CGGCTGCTGGGAAGTGGAGCAGG - Intergenic
1049451801 8:142666023-142666045 CGGCTGCCGGGAAGAGCAGAGGG - Exonic
1049766650 8:144358235-144358257 CGGCTGCCGGGGAGTGCGGCGGG + Exonic
1051170474 9:14315064-14315086 CGGCTGCCGGGAAAAGGGGGAGG + Intronic
1052362191 9:27573365-27573387 CGGCTGCCGGGAAGAGGCGCGGG - Intronic
1056768412 9:89459602-89459624 CAGCTGCAGGGAAGAGGCTCTGG - Intronic
1058908102 9:109497940-109497962 TGGCGGCCGGGACGCGGCGCCGG - Intronic
1060856022 9:126915246-126915268 GGACGGCGGGGAAGAGGCGCGGG + Intronic
1061092303 9:128433561-128433583 GGGCTGCATGGAAGAGGAGCAGG - Intronic
1061208231 9:129176503-129176525 CTGCTGCCCGGAGGAGGTGCCGG - Exonic
1061939310 9:133875513-133875535 GGGCTGCCTGGAGGAGGCGCAGG + Intronic
1061958606 9:133976649-133976671 TAGCTGCCGGGAGAAGGCGCTGG - Intronic
1062238252 9:135522891-135522913 CAGCTGGCGGGATGAGGCTCAGG + Intronic
1062318515 9:135979438-135979460 CGGCTGCAGGGAGGAGGAGAGGG + Intergenic
1062579191 9:137222062-137222084 GAGCTGCCGGGCCGAGGCGCGGG - Intergenic
1062624643 9:137437232-137437254 GGGCTGCTTGGAGGAGGCGCTGG - Exonic
1185457665 X:318881-318903 CCTGTGCCGGGGAGAGGCGCTGG - Intergenic
1189323089 X:40097864-40097886 CGGCTGCGGGGGAGACGCGCAGG - Intronic
1190385377 X:49879036-49879058 AGGCTGGCGGGAAGGGGGGCGGG - Intergenic
1196765114 X:119236104-119236126 CGGCCGCGGGGGAGCGGCGCCGG + Intergenic
1197746149 X:129932941-129932963 CGGGAGCCGGGAGGAGGCTCCGG - Intergenic
1200073991 X:153542269-153542291 GGGCAGCCGGGAGGAGGCGGTGG + Intronic
1200129008 X:153830926-153830948 CGGCGGCGGGGGAGGGGCGCGGG + Intergenic
1200147073 X:153931946-153931968 CGGCTGTGGGGAAGAGGCTGTGG - Intronic