ID: 1052362943

View in Genome Browser
Species Human (GRCh38)
Location 9:27579312-27579334
Sequence TTAATCCTCCTGACATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052362942_1052362943 12 Left 1052362942 9:27579277-27579299 CCATTTTAAATACATACAATTAA No data
Right 1052362943 9:27579312-27579334 TTAATCCTCCTGACATCTCTAGG No data
1052362941_1052362943 13 Left 1052362941 9:27579276-27579298 CCCATTTTAAATACATACAATTA No data
Right 1052362943 9:27579312-27579334 TTAATCCTCCTGACATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052362943 Original CRISPR TTAATCCTCCTGACATCTCT AGG Intergenic
No off target data available for this crispr