ID: 1052363861

View in Genome Browser
Species Human (GRCh38)
Location 9:27589575-27589597
Sequence TCTCTCAGGGCTATGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052363861_1052363866 -9 Left 1052363861 9:27589575-27589597 CCAGCTGCCATAGCCCTGAGAGA No data
Right 1052363866 9:27589589-27589611 CCTGAGAGAAGCCACAGTTAGGG No data
1052363861_1052363869 29 Left 1052363861 9:27589575-27589597 CCAGCTGCCATAGCCCTGAGAGA No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363861_1052363864 -10 Left 1052363861 9:27589575-27589597 CCAGCTGCCATAGCCCTGAGAGA No data
Right 1052363864 9:27589588-27589610 CCCTGAGAGAAGCCACAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052363861 Original CRISPR TCTCTCAGGGCTATGGCAGC TGG (reversed) Intergenic