ID: 1052363863

View in Genome Browser
Species Human (GRCh38)
Location 9:27589588-27589610
Sequence CCTAACTGTGGCTTCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052363863_1052363869 16 Left 1052363863 9:27589588-27589610 CCCTGAGAGAAGCCACAGTTAGG No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052363863 Original CRISPR CCTAACTGTGGCTTCTCTCA GGG (reversed) Intergenic