ID: 1052363865 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:27589589-27589611 |
Sequence | CCCTAACTGTGGCTTCTCTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1052363865_1052363869 | 15 | Left | 1052363865 | 9:27589589-27589611 | CCTGAGAGAAGCCACAGTTAGGG | No data | ||
Right | 1052363869 | 9:27589627-27589649 | TCACTCCCCATCATCAGACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1052363865 | Original CRISPR | CCCTAACTGTGGCTTCTCTC AGG (reversed) | Intergenic | ||