ID: 1052363866

View in Genome Browser
Species Human (GRCh38)
Location 9:27589589-27589611
Sequence CCTGAGAGAAGCCACAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052363861_1052363866 -9 Left 1052363861 9:27589575-27589597 CCAGCTGCCATAGCCCTGAGAGA No data
Right 1052363866 9:27589589-27589611 CCTGAGAGAAGCCACAGTTAGGG No data
1052363858_1052363866 22 Left 1052363858 9:27589544-27589566 CCACAGGCCTTGGACCTGGAGCA No data
Right 1052363866 9:27589589-27589611 CCTGAGAGAAGCCACAGTTAGGG No data
1052363857_1052363866 23 Left 1052363857 9:27589543-27589565 CCCACAGGCCTTGGACCTGGAGC No data
Right 1052363866 9:27589589-27589611 CCTGAGAGAAGCCACAGTTAGGG No data
1052363859_1052363866 15 Left 1052363859 9:27589551-27589573 CCTTGGACCTGGAGCAGTCTCAT No data
Right 1052363866 9:27589589-27589611 CCTGAGAGAAGCCACAGTTAGGG No data
1052363860_1052363866 8 Left 1052363860 9:27589558-27589580 CCTGGAGCAGTCTCATGCCAGCT No data
Right 1052363866 9:27589589-27589611 CCTGAGAGAAGCCACAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052363866 Original CRISPR CCTGAGAGAAGCCACAGTTA GGG Intergenic