ID: 1052363867

View in Genome Browser
Species Human (GRCh38)
Location 9:27589600-27589622
Sequence ATGTAACGGCTCCCTAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052363867_1052363869 4 Left 1052363867 9:27589600-27589622 CCACAGTTAGGGAGCCGTTACAT No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363867_1052363873 30 Left 1052363867 9:27589600-27589622 CCACAGTTAGGGAGCCGTTACAT No data
Right 1052363873 9:27589653-27589675 AGCATCAGCTTCCAGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052363867 Original CRISPR ATGTAACGGCTCCCTAACTG TGG (reversed) Intergenic