ID: 1052363868 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:27589614-27589636 |
| Sequence | TGGGGAGTGAAGCAATGTAA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1052363868_1052363873 | 16 | Left | 1052363868 | 9:27589614-27589636 | CCGTTACATTGCTTCACTCCCCA | No data | ||
| Right | 1052363873 | 9:27589653-27589675 | AGCATCAGCTTCCAGCACAATGG | No data | ||||
| 1052363868_1052363869 | -10 | Left | 1052363868 | 9:27589614-27589636 | CCGTTACATTGCTTCACTCCCCA | No data | ||
| Right | 1052363869 | 9:27589627-27589649 | TCACTCCCCATCATCAGACAAGG | No data | ||||
| 1052363868_1052363874 | 21 | Left | 1052363868 | 9:27589614-27589636 | CCGTTACATTGCTTCACTCCCCA | No data | ||
| Right | 1052363874 | 9:27589658-27589680 | CAGCTTCCAGCACAATGGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1052363868 | Original CRISPR | TGGGGAGTGAAGCAATGTAA CGG (reversed) | Intergenic | ||