ID: 1052363868

View in Genome Browser
Species Human (GRCh38)
Location 9:27589614-27589636
Sequence TGGGGAGTGAAGCAATGTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052363868_1052363869 -10 Left 1052363868 9:27589614-27589636 CCGTTACATTGCTTCACTCCCCA No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363868_1052363874 21 Left 1052363868 9:27589614-27589636 CCGTTACATTGCTTCACTCCCCA No data
Right 1052363874 9:27589658-27589680 CAGCTTCCAGCACAATGGCCTGG No data
1052363868_1052363873 16 Left 1052363868 9:27589614-27589636 CCGTTACATTGCTTCACTCCCCA No data
Right 1052363873 9:27589653-27589675 AGCATCAGCTTCCAGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052363868 Original CRISPR TGGGGAGTGAAGCAATGTAA CGG (reversed) Intergenic