ID: 1052363869

View in Genome Browser
Species Human (GRCh38)
Location 9:27589627-27589649
Sequence TCACTCCCCATCATCAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052363862_1052363869 22 Left 1052363862 9:27589582-27589604 CCATAGCCCTGAGAGAAGCCACA No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363861_1052363869 29 Left 1052363861 9:27589575-27589597 CCAGCTGCCATAGCCCTGAGAGA No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363867_1052363869 4 Left 1052363867 9:27589600-27589622 CCACAGTTAGGGAGCCGTTACAT No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363863_1052363869 16 Left 1052363863 9:27589588-27589610 CCCTGAGAGAAGCCACAGTTAGG No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363865_1052363869 15 Left 1052363865 9:27589589-27589611 CCTGAGAGAAGCCACAGTTAGGG No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data
1052363868_1052363869 -10 Left 1052363868 9:27589614-27589636 CCGTTACATTGCTTCACTCCCCA No data
Right 1052363869 9:27589627-27589649 TCACTCCCCATCATCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052363869 Original CRISPR TCACTCCCCATCATCAGACA AGG Intergenic