ID: 1052363874

View in Genome Browser
Species Human (GRCh38)
Location 9:27589658-27589680
Sequence CAGCTTCCAGCACAATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052363868_1052363874 21 Left 1052363868 9:27589614-27589636 CCGTTACATTGCTTCACTCCCCA No data
Right 1052363874 9:27589658-27589680 CAGCTTCCAGCACAATGGCCTGG No data
1052363871_1052363874 2 Left 1052363871 9:27589633-27589655 CCCATCATCAGACAAGGCTTAGC No data
Right 1052363874 9:27589658-27589680 CAGCTTCCAGCACAATGGCCTGG No data
1052363872_1052363874 1 Left 1052363872 9:27589634-27589656 CCATCATCAGACAAGGCTTAGCA No data
Right 1052363874 9:27589658-27589680 CAGCTTCCAGCACAATGGCCTGG No data
1052363870_1052363874 3 Left 1052363870 9:27589632-27589654 CCCCATCATCAGACAAGGCTTAG No data
Right 1052363874 9:27589658-27589680 CAGCTTCCAGCACAATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052363874 Original CRISPR CAGCTTCCAGCACAATGGCC TGG Intergenic