ID: 1052364440

View in Genome Browser
Species Human (GRCh38)
Location 9:27596202-27596224
Sequence CTTGTTGAGCAGTGTTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052364436_1052364440 23 Left 1052364436 9:27596156-27596178 CCATAACAGTATCAGTATTTTTC No data
Right 1052364440 9:27596202-27596224 CTTGTTGAGCAGTGTTGCTAAGG No data
1052364435_1052364440 24 Left 1052364435 9:27596155-27596177 CCCATAACAGTATCAGTATTTTT No data
Right 1052364440 9:27596202-27596224 CTTGTTGAGCAGTGTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052364440 Original CRISPR CTTGTTGAGCAGTGTTGCTA AGG Intergenic
No off target data available for this crispr