ID: 1052364441

View in Genome Browser
Species Human (GRCh38)
Location 9:27596203-27596225
Sequence TTGTTGAGCAGTGTTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052364435_1052364441 25 Left 1052364435 9:27596155-27596177 CCCATAACAGTATCAGTATTTTT No data
Right 1052364441 9:27596203-27596225 TTGTTGAGCAGTGTTGCTAAGGG No data
1052364436_1052364441 24 Left 1052364436 9:27596156-27596178 CCATAACAGTATCAGTATTTTTC No data
Right 1052364441 9:27596203-27596225 TTGTTGAGCAGTGTTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052364441 Original CRISPR TTGTTGAGCAGTGTTGCTAA GGG Intergenic
No off target data available for this crispr