ID: 1052365117

View in Genome Browser
Species Human (GRCh38)
Location 9:27603528-27603550
Sequence TTTGTATTGTAACTGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052365117_1052365121 16 Left 1052365117 9:27603528-27603550 CCTGGGTTCAGTTACAATACAAA No data
Right 1052365121 9:27603567-27603589 GTTTTATAAACAAAATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052365117 Original CRISPR TTTGTATTGTAACTGAACCC AGG (reversed) Intergenic
No off target data available for this crispr