ID: 1052365118

View in Genome Browser
Species Human (GRCh38)
Location 9:27603551-27603573
Sequence ATAAAACTGTGGAATAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052365118_1052365123 30 Left 1052365118 9:27603551-27603573 CCTTACCTATTCCACAGTTTTAT No data
Right 1052365123 9:27603604-27603626 CCCTGTTATCATTTACTTCAAGG No data
1052365118_1052365121 -7 Left 1052365118 9:27603551-27603573 CCTTACCTATTCCACAGTTTTAT No data
Right 1052365121 9:27603567-27603589 GTTTTATAAACAAAATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052365118 Original CRISPR ATAAAACTGTGGAATAGGTA AGG (reversed) Intergenic
No off target data available for this crispr