ID: 1052365619

View in Genome Browser
Species Human (GRCh38)
Location 9:27608994-27609016
Sequence CTGTTCCCATGGAGGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052365612_1052365619 6 Left 1052365612 9:27608965-27608987 CCTGGTGGAAGAAACATCATCCT 0: 1
1: 9
2: 6
3: 16
4: 180
Right 1052365619 9:27608994-27609016 CTGTTCCCATGGAGGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052365619 Original CRISPR CTGTTCCCATGGAGGTGACA GGG Intergenic
No off target data available for this crispr