ID: 1052371111

View in Genome Browser
Species Human (GRCh38)
Location 9:27665448-27665470
Sequence AAAACTCCTGCACTTCGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052371108_1052371111 17 Left 1052371108 9:27665408-27665430 CCTATGTAAATCAGATACCTTCT No data
Right 1052371111 9:27665448-27665470 AAAACTCCTGCACTTCGCCATGG No data
1052371109_1052371111 0 Left 1052371109 9:27665425-27665447 CCTTCTCCTCAAGCTCATCTATA No data
Right 1052371111 9:27665448-27665470 AAAACTCCTGCACTTCGCCATGG No data
1052371107_1052371111 18 Left 1052371107 9:27665407-27665429 CCCTATGTAAATCAGATACCTTC No data
Right 1052371111 9:27665448-27665470 AAAACTCCTGCACTTCGCCATGG No data
1052371110_1052371111 -6 Left 1052371110 9:27665431-27665453 CCTCAAGCTCATCTATAAAAACT No data
Right 1052371111 9:27665448-27665470 AAAACTCCTGCACTTCGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052371111 Original CRISPR AAAACTCCTGCACTTCGCCA TGG Intergenic
No off target data available for this crispr