ID: 1052373205

View in Genome Browser
Species Human (GRCh38)
Location 9:27689209-27689231
Sequence TCGCCCTGAACAAAAAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052373205_1052373210 25 Left 1052373205 9:27689209-27689231 CCCTGGTTTTTTGTTCAGGGCGA No data
Right 1052373210 9:27689257-27689279 CAAATCTTTTGCTCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052373205 Original CRISPR TCGCCCTGAACAAAAAACCA GGG (reversed) Intergenic
No off target data available for this crispr