ID: 1052374028

View in Genome Browser
Species Human (GRCh38)
Location 9:27697646-27697668
Sequence TTGTCAAAGTACATGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052374028_1052374032 2 Left 1052374028 9:27697646-27697668 CCAAGATCCATGTACTTTGACAA No data
Right 1052374032 9:27697671-27697693 AAGACAACATCAAGATCCTGGGG No data
1052374028_1052374034 7 Left 1052374028 9:27697646-27697668 CCAAGATCCATGTACTTTGACAA No data
Right 1052374034 9:27697676-27697698 AACATCAAGATCCTGGGGAAGGG No data
1052374028_1052374030 0 Left 1052374028 9:27697646-27697668 CCAAGATCCATGTACTTTGACAA No data
Right 1052374030 9:27697669-27697691 TCAAGACAACATCAAGATCCTGG No data
1052374028_1052374033 6 Left 1052374028 9:27697646-27697668 CCAAGATCCATGTACTTTGACAA No data
Right 1052374033 9:27697675-27697697 CAACATCAAGATCCTGGGGAAGG No data
1052374028_1052374036 9 Left 1052374028 9:27697646-27697668 CCAAGATCCATGTACTTTGACAA No data
Right 1052374036 9:27697678-27697700 CATCAAGATCCTGGGGAAGGGGG No data
1052374028_1052374035 8 Left 1052374028 9:27697646-27697668 CCAAGATCCATGTACTTTGACAA No data
Right 1052374035 9:27697677-27697699 ACATCAAGATCCTGGGGAAGGGG No data
1052374028_1052374031 1 Left 1052374028 9:27697646-27697668 CCAAGATCCATGTACTTTGACAA No data
Right 1052374031 9:27697670-27697692 CAAGACAACATCAAGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052374028 Original CRISPR TTGTCAAAGTACATGGATCT TGG (reversed) Intergenic
No off target data available for this crispr