ID: 1052375164

View in Genome Browser
Species Human (GRCh38)
Location 9:27711032-27711054
Sequence CATTGCCCAAAACAAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052375164_1052375170 13 Left 1052375164 9:27711032-27711054 CCAGACCCTTGTTTTGGGCAATG No data
Right 1052375170 9:27711068-27711090 GTGATTGATTGTGTGAATAAAGG No data
1052375164_1052375169 -9 Left 1052375164 9:27711032-27711054 CCAGACCCTTGTTTTGGGCAATG No data
Right 1052375169 9:27711046-27711068 TGGGCAATGCTAAGGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052375164 Original CRISPR CATTGCCCAAAACAAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr