ID: 1052375170

View in Genome Browser
Species Human (GRCh38)
Location 9:27711068-27711090
Sequence GTGATTGATTGTGTGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052375166_1052375170 7 Left 1052375166 9:27711038-27711060 CCTTGTTTTGGGCAATGCTAAGG No data
Right 1052375170 9:27711068-27711090 GTGATTGATTGTGTGAATAAAGG No data
1052375164_1052375170 13 Left 1052375164 9:27711032-27711054 CCAGACCCTTGTTTTGGGCAATG No data
Right 1052375170 9:27711068-27711090 GTGATTGATTGTGTGAATAAAGG No data
1052375165_1052375170 8 Left 1052375165 9:27711037-27711059 CCCTTGTTTTGGGCAATGCTAAG No data
Right 1052375170 9:27711068-27711090 GTGATTGATTGTGTGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052375170 Original CRISPR GTGATTGATTGTGTGAATAA AGG Intergenic
No off target data available for this crispr