ID: 1052376986

View in Genome Browser
Species Human (GRCh38)
Location 9:27728716-27728738
Sequence CACGCACAGCACGAGCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052376984_1052376986 14 Left 1052376984 9:27728679-27728701 CCAATGGTTTCAAACTCACACGT No data
Right 1052376986 9:27728716-27728738 CACGCACAGCACGAGCTTGAGGG No data
1052376983_1052376986 15 Left 1052376983 9:27728678-27728700 CCCAATGGTTTCAAACTCACACG No data
Right 1052376986 9:27728716-27728738 CACGCACAGCACGAGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052376986 Original CRISPR CACGCACAGCACGAGCTTGA GGG Intergenic
No off target data available for this crispr