ID: 1052378222 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:27741671-27741693 |
Sequence | CCGTATTTCCTCACCAAGCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1052378222_1052378233 | 28 | Left | 1052378222 | 9:27741671-27741693 | CCCTGCTTGGTGAGGAAATACGG | No data | ||
Right | 1052378233 | 9:27741722-27741744 | ACTTTTCTGTAGGACTGCTGTGG | No data | ||||
1052378222_1052378228 | 3 | Left | 1052378222 | 9:27741671-27741693 | CCCTGCTTGGTGAGGAAATACGG | No data | ||
Right | 1052378228 | 9:27741697-27741719 | TGGGCACCCATGTAACAGTCTGG | No data | ||||
1052378222_1052378231 | 18 | Left | 1052378222 | 9:27741671-27741693 | CCCTGCTTGGTGAGGAAATACGG | No data | ||
Right | 1052378231 | 9:27741712-27741734 | CAGTCTGGCCACTTTTCTGTAGG | 0: 23 1: 57 2: 122 3: 223 4: 662 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1052378222 | Original CRISPR | CCGTATTTCCTCACCAAGCA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |