ID: 1052378222

View in Genome Browser
Species Human (GRCh38)
Location 9:27741671-27741693
Sequence CCGTATTTCCTCACCAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052378222_1052378233 28 Left 1052378222 9:27741671-27741693 CCCTGCTTGGTGAGGAAATACGG No data
Right 1052378233 9:27741722-27741744 ACTTTTCTGTAGGACTGCTGTGG No data
1052378222_1052378228 3 Left 1052378222 9:27741671-27741693 CCCTGCTTGGTGAGGAAATACGG No data
Right 1052378228 9:27741697-27741719 TGGGCACCCATGTAACAGTCTGG No data
1052378222_1052378231 18 Left 1052378222 9:27741671-27741693 CCCTGCTTGGTGAGGAAATACGG No data
Right 1052378231 9:27741712-27741734 CAGTCTGGCCACTTTTCTGTAGG 0: 23
1: 57
2: 122
3: 223
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052378222 Original CRISPR CCGTATTTCCTCACCAAGCA GGG (reversed) Intergenic
No off target data available for this crispr